GGAT

AcronymDefinition
GGATGlamorgan-Gwent Archaeological Trust (UK)
GGATGeneral Genetic Algorithm Tool (Java program)
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
As autocratic guardians of our heritage, Cadw and GGAT are setting an appalling example to the world and one does wonder if they are fit for purpose.
After discussions in 2017 between GGAT's contractors, Orion Heritage, and Monmouth Civic Society, GGAT's said "a watching brief was acceptable to the developers and could be secured by an appropriately-worded planning condition".
A spokeswoman said the Glamorgan-Gwent Archaeological Trust (GGAT) and Merthyr Tydfil County Borough Council's planning department had been notified.
Primer information for real-time qRT-PCR Name Gene ID Primer (5' to 3') PPAR[gamma] NM_181024 Sense: GATAGGTGTGATCTTAAC TGTC GGAT Anti-sense: CGCTAACAGCTTCTCCTTCTCG FASN NM_001012669 Sense: CTGGAGCGTGAGCACAACCTG Anti-sense: GTGTGGAGTCCGTCAGCTCAT ACADM BC102989 Sense: TGTGCCTATTGTGTAACAGAACCT Anti-sense: TCCATTGGTGATCCACATCTTCTGAC GAPDH NM_001034034 Sense: CGTGTCTGTTGTGGATCTGACCTG Anti-sense: CAACCTGGTCCTCAGTGTAGCCT
Characteristics of ten microsatellites in this study Marker Chromosome DYE name location Repeat name PEZ1 CFA07 Di_repeat FAM (blue) FH2054 CFA12 (GATA)~16 FAM (blue) FH2010 Synt05 (CAAA)10 FAM (blue) PEZ5 CFA12 Tetra_repeat JOE (green) PEZ12 CFA03 Tetra_repeat JOE (green) PEZ3 CFA19 Tetra_repeat NED (yellow) PEZ6 CFA27 Tetra_repeat NED (yellow) PEZ8 CFA17 Tetra_repeat NED (yellow) FH2079 CFA24 Mix (GGAT)~47 scrambled NED (yellow) PEZ20 -- Tetra_repeat JOE (green) Marker Allele range Annealing temp.
It is beyond comprehension that the county council's archaeological advisers, Glamorgan Gwent Archaeological Trust (GGAT), should think that the busy lives of the Stone Age people on the lake and along its shores should stop at a modern hedge.
Both Cad wand the Glamorgan Gwent Archaeological Trust (GGAT) rejected the criticisms and defended the work at Cardiff Castle.
A statement read: "In conjunction with GGAT, we have appointed consultants Archaeology Wales to conduct a full investigation of the building and we anticipate they will commence their work in May 2018." The company says visits to the site by the public are not possible due to the safety risk.
Their complaints, which focused on the body that carried out the work, the Glamorgan Gwent Archaeological Trust (GGAT), were submitted later in 2006 and investigated by the IFA.
But Andrew Marvell, acting director for GGAT, refuted this claim.``That is not correct.