GLMM

AcronymDefinition
GLMMGacha Life Mini Movie
GLMMGeneral Linear Mixed Model
GLMMGeneralized Linear Mixed Effects Model
GLMMGreat Lakes Maritime Museum (Sebewaing, Michigan)
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
3A; GLMM with Poisson distribution: total nests, n= 111, b= 0.015, SE = 0.005, F=9.65, P = 0.002), two-egg clutches (Fig.
The final germination proportion of the treatments was analyzed by multiple regression generated by GLMM or GLM (General Linear Models), the latter when the random effect was not significant.
Figure 1 shows GLMM estimated mean ventilation rates by a) the month each year and b) the day of the week.
Generalized linear mixed-effects models (GLMMs), without considering any interactions, were used to examine the effects of different diets on (1) larval survival until first-stage mysis, (2) the number of days required to reach first-stage mysis, (3) the relationship between LSI and larval age (DAH), and (4) larval body length at first-stage mysis.
GLMM assumptions include: (i) that the dependent variable (HbA1c) is a normally distributed, continuous variable; (ii) that the residuals of the dependent variable are normally distributed; (iii) that at least 10% of the total variance in the dependent variable must be explained at the level 2 variable (i.e.
In particular, the R package lme4 (Bates, 2014) was used to fit the GLMM.
For the 27 basins surveyed from 2011 to 2015, the number of years elapsed since a major ice-jam flood in the PAD remained the best predictor of the density of muskrat houses in basins (GLMM: estimate = -1.54, SE = 0.18, z = -8.70, p < 0.0001; Table 2).
The amplification was carried out in a thermal cycler as previously mentioned in ureC (glmM) gene but the annealing temperature was 55[degrees]C for cagA, 56[degrees]C for iceA1, and 50[degrees]C for iceA2.
Specifically, consider the GLMM response model (1) and the covariate model (2).
Gene Primer Nucleotide sequence ureC (glmM) Hp-F GGATAAGCTTTTAGGGGTGTTAGGGG HP-R GCTTACTTTCTAACACTAACGCGC cag E cag E-F TTGAAAACTTCAAGGATAGGATAGAGC cagE-R GCCTAGCGTAATATCACCATTACCC bab A2 bab A2-F CCAAACGAAACAAAAAGCGT bab A2-R GCTTGTGTAAAAGCCGTCGT babB babB -F ATGAAAAAAACCCTTTTAC babB-R CGAATTGCAAGTGATGGT cagA cagA-F AGGGATAACAGGCAAGCTTTTGA cagA-R CTGCAAAAGATTGTTTGGCAGA iceAl iceAl-F GTGTTTTTAACCAAAGTATC iceAl-R CTATAGCCASTYTCTTTGCA iceA2 iceA2-F GTTGGGTATATCACAATTTAT iceA2-R TTRCCCTATTTTCTAGTAGGT Gene Size (bp) Reference ureC (glmM) 294 [13] cag E 508 [12] bab A2 971 [6] babB 496 [14] cagA 352 [15] iceAl 247 [13] iceA2 229 [13] TABLE 2: Relationship between clinical outcome and status of cagE, babA2, babB, iceAl, iceA2, and CagA.
Normanno et al., "High occurrence of Helicobacter pylori in raw goat, sheep and cow milk inferred by glmM gene: a risk of food-borne infection?," International Journal of Food Microbiology, vol.
Parameters were estimated by the generalized linear mixed model (glmm) procedure in SPSS IBM 24.0 (rating DV probability distribution: normal; link function: identity), and least significant difference (LSD) was used to compare estimated marginal means.