GNRHR

AcronymDefinition
GNRHRGonadotropin-Releasing Hormone Receptor
References in periodicals archive ?
Recent study found that intramuscular injection of 200 mg or 400 mg genistein did not change the expression of GNRHR of crossbred barrows (Clapper and Tomlin, 2012).
This delay in the onset of puberty following SIF inclusion could be attributed to the reduced serum GnRH and LH concentration, suppressing effect on the gene expression of KISS1 (in the hypothalamus), GNRHR gene expression (in the pituitary), down regulating effect on StAR and 3P-HSD expression (in the ovary) resulting in altered synthesis of steroid hormones in growing Bama miniature pigs.
1 F: GAGCCAATTCCGAAACTTCTAGC 267 R: CTTCTGCCCAGTTTCCTCTTCA GNRHR NM 214273.