GNY

AcronymDefinition
GNYGreater New York
GNYGo Null Yourself (online programming community)
GNYGong-Needham-Yahalom (logic theory; cryptology)
GNYGamble Nippert YMCA (Cincinnati, Ohio)
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
Section 3 provides the design of the proposed authentication protocol as well as a proof of security using the logic of GNY. The results of the implementation will be explained in Section 4.
[45] Pieter and Michiel, "Analysis of the OpenPGP and OTR protocols", using GNY logic (Online Tutorial), Available from: http://www.ai.rug.nl/mas/finishedprojects/2007/PieterMichiel/ gny.html
With respect to individual mines, the policies had significant impacts only for Oaky Creek (OCJ), Goonyella (GNY), South Walker Creek (SWC) and Riverside (RSD).
Yet there is no shortage of others who appeared in "GNY 2000" who have continued to exhibit extensively in New York and around the globe: Rachel Harrison, Piotr Uklanski, Elizabeth Peyton, T.
Tickers featured: BNP_UN:TSX, BR, CBM, CMT:TSX, CNQ, CR:TSX, CYS:TSX, DCE:TSX, DEN:TSX, DVN, ECA, FEL:TSX, GNY:TSX, HSE:TSX, IMO, NVA:TSX, NXY, PEY_UN:TSX, PWT:TSX, PXE:TSX, RER:TSX, RSE:TSX, SU, SVY:TSX, TCW:TSX, THY:TSX, TLM, UTS:TSX, WTO:TSX, ZAR_UN:TSX.
# TODAY'S numbers are: X486 GEH Y64 GNY To claim, simply call 029 2058 3471 between 9am and noon tomorrow.
The SS thing: this gny, Nate Wilson (ex-Devoid of Faith, Monster X), we hung out one time working together in Daytona Beach for Spring Break handing out promo items for his website.
Thomas Hughes, Executive Vice President 8c General Counsel, Corporate Secretary for Greater New York Mutual Insurance Company, has been with GNY for over 19 years.
Isolate Nucleotide sequence PAO1 ATGGCGAGCGACCTTGGATTCTCGAAGATCCTGTTCGGCCTGTTGCCTAAGGACAGCCAGG ACTACGAGAACGCCTTCATCGTCGGCAACTAC P1A ATGGCGAGCGACCTTGGATTCTCGAAGATCCTGTTCGGCCTGTTGCCTAAGGACAGCCAGGA CTACGAGAACGCCTTCATCGTCG (**) G (*) CAACTAC P7B ATGGCGAGCGACCTTGGATTCTCGAAGATCCTCTTCGGCCTGTTGCCTAAGGACAGCCAGGA CTACGAGAACGCCTTCATCGTCGTC (**) G (*) CAACTAC P20B ATGGCGAGCGACCTTGGATTCTCGAAGATCCTGTTCGGCCTGTTGCCTAAGGACAGCCAGGA CTACGAGAACGCCTTCATCGTCGTC (**) G (*) CAACTAC Isolate Amino acid sequence PAO1 MASDLGFSKILFGLLPKDSQDYENAFIVGNYFrame +1 P1A MASDLGFSKILFGLLPKDSQDYENAFIV (#) GNY P7B MASDLGFSKILFGLLPKDSQDYENAFIV (#) GNY P20B MASDLGFSKILFGLLPKDSQDYENAFIV (#) GNY (*) Regions where nucleotide insertions (T, C and G) occurred, respectively, in clinical isolates of non-biofilm producing P.
Spreadsheets are crucial for GNY to grasp its exposure in New York City, she explains, considering that many of its locations there are lying literally right on top of each other in the same buildings.
Tickers featured: APA, BTE_UN:TSX, CNQ, ESI:TSX, FCP:TSX, GNY:TSX, NKO:TSX, PGX_UN:TSX, PKZ, PXE:TSX, SU, TCW:TSX, TGA, TLM, TRGL, TUI:TSX, ZAR:TSX.
The complainant said Ramesh and theEe two journalists , through aACoedeliberate insinuationsaACA[yen] had made aACoegrave and serious allegationsaACA[yen] of money laundering against GNY Asia, a hedge fund based out of Cayman Islands, aACoewhich is a legitimate and ethical business venture of the complainant, not only without any proof thereof but being completely aware of the falsity thereof.aACA[yen]