GPX1

AcronymDefinition
GPX1Glutathione Peroxidase 1
References in periodicals archive ?
The protective effect of CC genotype might be due to that, this genotype demonstrates relatively high activity of GPX1 enzyme compared to CT or TT variant of alleles which is also reported in literature Najafi et al.
GPX1 has been implicated in the development and prevention of many common and complex diseases, including cancer and cardiovascular disease.
APOA5 (b) Chr11 4 1101 False LDLRAP1 Chr1 9 927 False MMP9 Chr20 13 2124 False PDGFRB Chr5 23 3321 False VEGFA Chr6 7 1239 False ACTA2 Chr10 9 1134 True APOC3 Chr11 4 300 False CAV1 Chr7 3 537 False CD40 Chr20 9 834 False CETP Chr16 16 1482 False CIITA Chr16 20 3396 False FGG Chr4 10 1362 True GPX1 Chr3 1 612 True LPL Chr8 10 1428 False MBL2 Chr10 4 747 True MVK Chr12 11 1191 False PITX2 Chr4 6 954 False TNFRSF1A Chr12 10 1368 False UCP2 Chr11 8 930 False Gene name GC content APOA5 (b) 0.
We found that gene expression of GPX1 was significantly higher in some cases double in egg cells that yielded a pregnancy.
2015) also observed that dietary vitamin E, ferulic acid or their combination supplementation did not alter mRNA expression of genes that involved in Nrf2 path way including nuclear factor erythroid 2-related factor-antioxidant response element and GPX1 in pigs.
To the best of our knowledge, even though the role of oxidative stress and GSTM1, GSTT1, GSTP1, CAT, and GPX1 as well as MnSOD2 in the pathogenesis of cancer have been previously investigated, no studies on the association of all these six polymorphisms with acute myeloid leukemia have been previously published.
In the present study, we measured the genotype frequencies of CAT, GPX1, and SOD2 polymorphisms in PXE patients and healthy control individuals.
Real-time quantitative PCR primers for NFE2L2-ARE related genes and [beta]-actin of the finishing pigs Gene Primer sequence (5' to 3') Product length (bp) [beta]-actin Forward: ATGGTGGGTATGGGTCAGAA 122 Reversed: TTCTCCATGTCGTCCCAGTT GPX1 Forward: AGCCCAACTTCATGCTCTTC 159 Reversed: CATT GCGACAC AC TGGAGAC GCLC Forward: CAAACCATCCTACCCTTTGG 172 Reversed: ATTGTGCAGAGAGCCTGGTT GCLM Forward: ACAATACAACGGTT 119 CAGGTGAGT Reversed: GCCTGTAAAATGTGTCATTGAGG NFE2L2 Forward: GAAAGCCCAGTCTTCATTGC 190 Reversed: TTGGAACCGTGCTAGTCTCA Gene Annealing temperature GenBank accession no.
Gene Forward Reverse Catalase 5' CAAGCTGGTTAATGCGAATGG 3' 5' TTGAAAAGATCTCGGAGGCC 3' GPX1 5' AATCAGTTCGGACATCAGGAG 3' 5' GAAGGTAAAGAGCGGGTGAG 3' GPX2 5' TCCCTTGCAACCAGTTCG 3' 5' TCTGCCCATTGACATCACAC 3' GPX3 5' CAGCTACTGAGGTCTGACAG 3' 5' ACTAGGCAGGATCTCCGAG 3' SOD1 5' TGTGTCCATTGAAGATCGTGTG 3' 5' CTTCCAGCATTTCCAGTCTTTG 3' SOD2 5' GGACAAACCTGAGCCCTAAG 3' 5' CAAAAGACCCAAAGTCACGC 3' SOD3 5' GACCTGGAGATCTGGATGGA 3' 5' GTGGTTGGAGGTGTTGTGCT 3' NOX2 5' CAATTCACACCATTGCACATC 3' 5' CGAGTCACAGCCACATACAG 3' NOX4 5' TCCATCAAGCCAAGATTCTGAG 3' 5' GGTTTCCAGTCATCCAGTAGAG 3' DUOX1 5' GATACCCAAAGCTGTACCTCG 3' 5' GTCCTTGTCACCCAGATGAAG 3' GUS 5' GGTCGTGATGTGGTCCTGTC 3' 5' TGTCTGCGTCATATCTGGTATTG 3' GPX: glutathione peroxidase; SOD: superoxide dismutase; NOX: NADPH oxidase.
In the current study, we aimed to determine the relationship between SOD2, GPX1, PPAR-[gamma] genotypes, and the risk of developing ESRD among patients of Han origin, using a large multicenter cohort.
GPX1, GPX5, and GPX8 prevent peroxide-induced oxidative damage, lipid peroxidation, and protein degradation [63-65].