GTCT

AcronymDefinition
GTCTGeneral Terms and Conditions of Trade
GTCTGlobal Tropical Cyclone Track
GTCTGross Toxicity Concentration Tested
References in periodicals archive ?
(BULLETIN BOARD: TCOM), Hong Kong, the Total Solutions Provider, has announced that its subsidiaries, IC Star MMS Limited and Guangzhou TCOM Computer Tech Limited (GTCT), have jointly released a new online performing education college called MyStarU.com ( http://www.mystaru.com/ ).
Primer sequence and location in Mycobacterium ulcerans and amplicon length at loci 1, 6, 9, and 33, resulting from a polymorphism in tandem repeat copy numbers Primer sequence Locus Forward primer (5'-3') Reverse primer (5'-3') Location 1 GCTGGTTCATGCGTGGAAG GCCCTCGGGAATGTGGTT mu0115C04F 6 GACCGTCATGTCGTTCGATCC GACATCGAAGAGGTGTGCC mu0019B07G TAGT GTCT 9 GCCGAAGCCTTGTTGGACG GGTTTCCCGCAGCATCTCG mu0113D07F 33 CAAGACTCCCACCGACAGGC CGGATCGGCACGGTTCA mu043E11R Amplicon length Locus 1 copy 2 copies 3 copies 4 copies 1 380 433 486 539 6 500 556 -- -- 9 435 488 -- -- 33 720 778 836 --
The frequencies of the ATCG and GTCT haplotypes were statistically lower in children with ASD compared to healthy controls [23].