References in periodicals archive ?
The primer pairs for each gene target were C/EBP [alpha]: (CCAAT/enhancer-binding protein [alpha]): forward-TAACTCCCCCATGGAGTCGG, reverse-TATAGACGTCTCGTGCTCGC; LPL (lipoprotein lipase): forward-GATC CGAGTGAAAGCCGGAG, reverse-TTGT TTGT CCAGTGTCAGCCA; SREBF1 (sterol regulatory element binding factor 1): forward-CTTTTCCTTAAGGTGGGCCT, reverse-AGCTGGAGCATGTCTTCGAT; PPAR[gamma] 1/2 (peroxisome proliferator-activated receptor [gamma] 1/2): forward-GCCTGCGG AAGCCCTTTGGT, reverse-GCAGTTCC AGGGCCTGCAGC; aP2: forward-GGAA GCTT GTCT CCAGTGAA, reverse-GCGG TGATTTCATCGAATTC; Adipsin: forward-CCTGAACC CTAC AAGCGATG, reverse-CAACGAGGCATT CTGGGATAG; Perilipin: forward-TTGG GGATGGCCAAAGAGAC, reverse-CTCA CAAGGCTTGGTTTGGC; and [beta]-actin: forward-GACTTCGAGCAAGAGATGGC, reverse-CCAGACAGCACTGTGTTGGC.
Primer sequence and location in Mycobacterium ulcerans and amplicon length at loci 1, 6, 9, and 33, resulting from a polymorphism in tandem repeat copy numbers Primer sequence Locus Forward primer (5'-3') Reverse primer (5'-3') Location 1 GCTGGTTCATGCGTGGAAG GCCCTCGGGAATGTGGTT mu0115C04F 6 GACCGTCATGTCGTTCGATCC GACATCGAAGAGGTGTGCC mu0019B07G TAGT GTCT 9 GCCGAAGCCTTGTTGGACG GGTTTCCCGCAGCATCTCG mu0113D07F 33 CAAGACTCCCACCGACAGGC CGGATCGGCACGGTTCA mu043E11R Amplicon length Locus 1 copy 2 copies 3 copies 4 copies 1 380 433 486 539 6 500 556 -- -- 9 435 488 -- -- 33 720 778 836 --