GTFB

AcronymDefinition
GTFBGreen Thumb Floral Boutique (Wilmington, NC)
References in periodicals archive ?
La curva de fusion obtenida en la identificacion del gen gtfB de S.
Sin embargo, un reciente estudio de cepas provenientes de la poblacion chilena reporta la presencia del gen gtfB en el 100% de las cepas de S.
Gene Primer seq 5'-3' gtfB F-AGCAATGCAGCCAATCTACAAAT R-ACGAACTTTGCCGTTATGTCA gtfC F-GGTTTAACGTCAAAATTAGCTGTATTAGC R-CTCAACCAACCGCCACTGTT ftf F-AAATATGAAGGCGGCTACAACG R-CTTCACCAGTCTTAGCATCCTGAA gbpB F-ATGGCGGTrATGGACACGTT R-TTTGGCCACCTTGAACACCT VicR F-TGACACCAUACAGCCITFGATG R-CGTCTAGTTCTCGTAACATTAACTCCAATA brpA F-GGAGGAGCTGCATCAGGATTC R-AACTCCAGCACATCCAGCAAG RelA F-ACAAAAAGGGTATCGTCCGTACAT R-AATCACGCTTGGTAUGCTAATTG spaP F-GAGGTAATGGTFATGCATCAA R-TITGTATCAGCCGGATCAAGTG 16S rRNA F-CCTACGGGAGGCAGCAGTAG R-CAACAGAGCTTTACGATCCGAAA Smu0630 F-GTTAGTTCTGGTTTTGACCGCAAT R-CCCTCAACAACAACATCAAAGGT F-forward; R-reverse.
Protein sequences for gtfC (BAA26102), gtfB (BAA26105), brpA (NP_720858) and spaP (NP_721042) were downloaded from NCBI database.
The mRNA levels of bacterial gtfB and gtfD were increased 1.5- and 1.7-fold, respectively, at 1 mg/ml of nicotine.
Primers Sequences 16S rRNA F 5'-AGCGTTGTCCGGATTTATTG-3' R 5'-CTACGCATTTCACCGCTACA-3' gtfB F 5'-CACTATCGGCGGTTACGAAT-3' R 5'-CAATTTGGAGCAAGTCAGCA-3' gtfC F 5'-GATGCTGCAAACTTCGAACA-3' R 5'-TATTGACGCTGCGTTTCTTG-3' gtfD F 5'-TTGACGGTGTTCGTGTTGAT-3' R 5'-AAAGCGATAGGCGCAGTTTA-3'
Estas GTF--en particular la GTFB y la GTFC--se unen con avidez a la pelicula que se forma en la superficie del diente y a la superficie de otros microorganismos, modulando la formacion de biopeliculas fuertemente adheridas.
Se ha probado tambien la proteccion anticaries de la vacuna de ADN, denominada pGJA-P/VAX, en la cual fusionaron el fragmento de que codifica para GLU de la GTFB del S.
mutans produce tres GTFs, las cuales estan codificadas por tres genes gtfB, gtfC y ggtfD.
La GTFB y la GTFD contienen 1475 aa y son altamente hidrofilicas, mientras que la GTFC esta compuesta por 1375 aa y presenta un caracter mas anfifilico (posee partes tanto hidrofobicas como hidrofilicas en su estructura)(56) debido a pequenos dominios hidrofobicos, caracteristica que le puede conferir mayor afinidad a la hidroxiapatita del esmalte dental, constituyendose en la isoforma predominante en la pelicula adquirida.
RecA-dependent recombination of the gtfB and gtfC genes has been reported to occur at a frequency of [10.sup.-3] in S.