GTFB

AcronymDefinition
GTFBGreen Thumb Floral Boutique (Wilmington, NC)
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
Gene Primer seq 5'-3' gtfB F-AGCAATGCAGCCAATCTACAAAT R-ACGAACTTTGCCGTTATGTCA gtfC F-GGTTTAACGTCAAAATTAGCTGTATTAGC R-CTCAACCAACCGCCACTGTT ftf F-AAATATGAAGGCGGCTACAACG R-CTTCACCAGTCTTAGCATCCTGAA gbpB F-ATGGCGGTrATGGACACGTT R-TTTGGCCACCTTGAACACCT VicR F-TGACACCAUACAGCCITFGATG R-CGTCTAGTTCTCGTAACATTAACTCCAATA brpA F-GGAGGAGCTGCATCAGGATTC R-AACTCCAGCACATCCAGCAAG RelA F-ACAAAAAGGGTATCGTCCGTACAT R-AATCACGCTTGGTAUGCTAATTG spaP F-GAGGTAATGGTFATGCATCAA R-TITGTATCAGCCGGATCAAGTG 16S rRNA F-CCTACGGGAGGCAGCAGTAG R-CAACAGAGCTTTACGATCCGAAA Smu0630 F-GTTAGTTCTGGTTTTGACCGCAAT R-CCCTCAACAACAACATCAAAGGT F-forward; R-reverse.
Protein sequences for gtfC (BAA26102), gtfB (BAA26105), brpA (NP_720858) and spaP (NP_721042) were downloaded from NCBI database.
The mRNA levels of bacterial gtfB and gtfD were increased 1.5- and 1.7-fold, respectively, at 1 mg/ml of nicotine.
Primers Sequences 16S rRNA F 5'-AGCGTTGTCCGGATTTATTG-3' R 5'-CTACGCATTTCACCGCTACA-3' gtfB F 5'-CACTATCGGCGGTTACGAAT-3' R 5'-CAATTTGGAGCAAGTCAGCA-3' gtfC F 5'-GATGCTGCAAACTTCGAACA-3' R 5'-TATTGACGCTGCGTTTCTTG-3' gtfD F 5'-TTGACGGTGTTCGTGTTGAT-3' R 5'-AAAGCGATAGGCGCAGTTTA-3'
Estas GTF--en particular la GTFB y la GTFC--se unen con avidez a la pelicula que se forma en la superficie del diente y a la superficie de otros microorganismos, modulando la formacion de biopeliculas fuertemente adheridas.
Se ha probado tambien la proteccion anticaries de la vacuna de ADN, denominada pGJA-P/VAX, en la cual fusionaron el fragmento de que codifica para GLU de la GTFB del S.
RecA-dependent recombination of the gtfB and gtfC genes has been reported to occur at a frequency of [10.sup.-3] in S.