GTFPGlobal Trade Finance Program (World Bank)
GTFPGreen Turtle Fibropapillomatosis
GTFPGet To the Friggin' Point
Copyright 1988-2018, All rights reserved.
References in periodicals archive ?
sanguinis gtfP Ssan-F GCAAAAAAGACTGTTACAGACAARATTG AB252650 (1 pro Ssan-R AGCTATCGCTCCCTGTCTTTGA genome) Ssan-S HEX-AGGTTGCAAAGAAAGATCGCTTGCCA-BHQ1 Species/ Primers/ Amplicon References acc.
In fiscal 2015, IFC's GTFP committed over $1 billion in the Middle East and North Africa region and over $6 billion around the world.
Summary: ABU DHABI - Union National Bank has joined the International Finance Corporation's, or IFC's, Global Trade Finance Programme (GTFP), to benefits from its guarantees in covering payments risks in under developed markets.
SABB's contribution to our programs and to cross-border trade in the region has been remarkable." Launched in 2005, the IFC's GTFP supports trade with emerging markets worldwide, seeking to increase developing countries' share of trade and promote cross-border flows of goods and services.
Moreover, the high growth rate of GDP per capita (equal or higher than the one observed in London) is not explained by a high level of technology (gTFP), but by a catch-up phenomenon.
On Saturday, IFC signed a similar agreement with AlexBank,which was also part of the GTFP.
Karachi -- Habib Metropolitan Bank was recently awarded by International Finance Corporation (IFC) - a member of World Bank Group at their 5th Annual Bank Partners Meeting in Dubai, as the "BEST GTFP ISSUING BANK FOR SOUTH-SOUTH TRADE".
In fiscal year 2013, IFC's GTFP committed over $1 billion to guarantee cross-border trade deals in the Middle East and North Africa, doubling its commitments since 2010.
IFC extended a $10 million trade credit line to Ohridska Banka under the Global Trade Finance Program (GTFP).
CAIRO: In 2010, the International Finance Corporation's Global Trade Finance Program (GTFP) issued 2,811 guarantees amounting to $3.4 billion, officials said at a conference Thursday.