GULO


Also found in: Dictionary, Thesaurus, Encyclopedia, Wikipedia.
Related to GULO: gulp
AcronymDefinition
GULOGeneral Union of Loom Overlookers (UK)
References in periodicals archive ?
Gene Primer pair Sequence Tm Product size (bp) [beta]-actin FP TCCTCCTGAGCGCAAGTACTCT 62 153 RP GCTCAGTAACAGTCCGCCTAGAA 62 GULO FP CTTTGTTCAACTTCCTGTGG 60 140 RP GGTAGTACATCTCTGGACTG 54 Table 3: Relative expression of GULOin treated and untreated 3T3-L1 cells.
Estimating wolverine (Gulo gulo) population size using quadrat sampling of tracks in snow.
We next examined whether expression of Gulo is correlated to the expression of any of those genes in mice.
Some of the smaller forest carnivores of the American West--the lynx (Lynx canadensis), wolverine (Gulo gulo), and fisher (Mattes pennanti)--have not yet grabbed headlines like bears (Ursus spp.) and wolves (Canis lupus).
Known as the glutton in Eurasia (the race Gulo gulo gulo) and as the wolverine in North America (the race Gulo gulo luscus), it is a carnivore that can attack much larger animals, but in the boreal forests it has to complement its diet with small rodents, eggs, nestlings, insects, wild fruit, and pine nuts.
'Pero ako para iwas gulo sa Panglalaki talaga ako aangal sila mas DAKS pa ko sa kanila (To avoid trouble I go to the men's room; they will complain that I have bigger genitals than they),' he joked.
"Later, sana naman walang gulo tayo sa plenary mamaya (hopefully we won't create any chaos at the plenary later), because the President doesn't want what happened last year, noong kanyang (during his) third SONA, to happen again this fourth SONA," Velasco told House members.
"'Pag may gulo,unang nawawala and edukasyonkaya lalong nagkakaroon ng gulo," Robin Padilla, actor, education advocate, and MoneyGram Global Brand ambassador, shared at a panel discussion during MoneyGram Foundation's book donation at Herminigildo Atienza Elementary School in Baseco, Manila.
According to the protesters, additional and sessions judge Swabi, the other day, issued release orders of Humayun Khan, a resident of Gulo Dherai in Swabi, who was arrested in a murder case.
The campus has been established by Pakistan Tehreek-e-Insaf government in a building which was built by the then Awami National Party government for agricultural research in Gulo Dheri (Bamkhel).