G3P

(redirected from Glyceraldehyde-3-phosphate)
Also found in: Medical.
AcronymDefinition
G3PGlyceraldehyde-3-Phosphate
G3PGlycerol 3 Phosphatase
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
List of primers used for quantitative real-time polymerase chain reaction Gene (ID) Primer sequence 5'-3' GAPDH F: AGGTCGGTGTGAACGGATTTG XM_017321385.1 R: TGTAGACCATGTAGTTGAGGTCA Caspase-3 F: AGCAGCTTTGTGTGTGTGATTCTAA XM_017312543.1 R: AGTTTCGGCTTTCCAGTCAGAC BAX F: CAGGATGCGTCCACCAAGAA XM_01 1250780.2 R: GCAAAGTAGAAGAGGGCAACCA PCNA F: TAAAGAAGAGGAGGCGGTAA NM_01 1045.2 R: TAAGTGTCCCATGTCAGCAA Cyclin B1 F: AGATGCAGTTGGCACCATGT NM_172301.3 R: TTCGACAACTTCCGTTAGCCT Annealing Fragment temperature Gene (ID) length (bp) ([degrees]C) GAPDH XM_017321385.1 123 60 Caspase-3 XM_017312543.1 137 60 BAX XM_01 1250780.2 197 60 PCNA NM_01 1045.2 175 60 Cyclin B1 NM_172301.3 148 60 GAPDH, glyceraldehyde-3-phosphate dehydrogenase; BAX, Bcl-2-associated X protein; PCNA, proliferating cell nuclear antigen.
Primer sequences Gene Sequence Accession No Tm ([degrees]C) 16S rRNA TCCTACGGGAGGCAGCAG (*) - 61 GGACTACNAGGGTATCNA (**) GAPDH TTGCCCTCAACGACCACTTT J02642 60 TGGTCCAGGGGTCTTACTCC Gene Product size 16S rRNA 245 GAPDH 120 Tm: Temperature GAPDH: glyceraldehyde-3-phosphate dehydrogenase (*) Universal forward primer used by Nadkarni et al.
Glyceraldehyde-3-phosphate dehydrogenase mRNA levels might be regulated under common situations, and in some cases, gapdh could be inappropriate as a reference gene for some experimental conditions.
AICAR: 5-amino-4-imidazolecarboxamide riboside-1-b-D-ribofuranoside; Egr1: early growth response factor 1; p-AMPK[alpha]: phosphorylated adenosine monophosphate-activated protein kinase a; AMPK[alpha]: adenosine monophosphate-activated protein kinase a; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.
Caption: Figure 2: Protein levels of vascular endothelial growth factor (VEGF), basic fibroblast growth factor (bFGF), and pigment epithelium-derived factor (PEDF) measured through Western blotting and normalized to the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) level.
B2M: [beta]-2-microglobulin; CLDN5: claudin 5; CTNNB1: catenin-[beta]1; DENV: dengue viral RNA; EIF2AK2: eukaryotic translation initiation factor 2-alpha kinase 2; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; IFITM1: interferon-induced transmembrane protein 1; IFN-[beta]: interferon-[beta]; IL-6: interleukin-6; ISG15: interferon-stimulated gene 15; JAM-3: junctional adhesion molecule 3; OCLN: occludin; PPIA: peptidylprolyl isomerase A; RSAD2: radical SAM domain-containing 2 (viperin); TBP: TATA-binding protein; TNF-[alpha]: tumor necrosis factor-[alpha]; ZO-1: zonula occludens 1.
The RNA samples were reversely transcribed into complementary DNA using a PrimeScript RT Reagent Kit (TAKARA) and the relative levels of TLR9, C3 and TGF-[beta]1 to the control glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were determined by quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) in the ABI 7500 realtime PCR system (Applied Biosystems) using SYBR green PCR master mixed kit and specific primers.
All samples were studied in triplicate and the mRNA abundance was normalized for each sample to the amount of glyceraldehyde-3-phosphate dehydrogenase (GAPDH).