HBEGF

AcronymDefinition
HBEGFHeparin Binding Epidermal Growth Factor
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
Primers and probes for aQRT-PCR Gene (a) Real-time PCR primers, 5' [right arrow] 3' HER-2 Forward GGATGTGCGGCTCGTACAC Reverse FAM-AGTGCTATCCGAGGGAATGACATGGTTGGGACTCTTGAC GAPDH Forward ROX-GTGCTATCCGAGGGAACCTGACCTGCCGTCTAGAAAA Reverse CTCCGACGCCTGCTTCAC TOP1 (103 bp) Forward FAM-AGTGCTATCCGAGGGAAGACAGCCCCGGATGAGAAC Reverse AAGAATTGCAACAGCTCGATTG HBEGF (99 bp) Forward FAM-AGTGCTATCCGAGGGAACCCCAGTTGCCGTCTAGGA Reverse CGGACATACTCTGTTTGGCACTT TBP (108 bp) Forward FAM-AGTGCTATCCGAGGGAAGGGCATTATTTGTGCACTGAGA Reverse AGCAGCACGGTATGAGCAACTGTCAGA MYC (134 bp) Forward FAM-AGTGCTATCCGAGGGAATCCTCCTTATGCCTCTATCAT Reverse CCGCGCTTTGATCAAGAGTCC Antiprimer TTCCCTCGGATAGCACT-BHQ2 (a) Fragment length in parentheses.
Laboratory research at Tufts University School of Medicine, led by Ira Herman, PhD, professor of physiology, cell and molecular biology and ophthalmology, shows that by combining an enzyme known as collagenase, which is manufactured by BioSpecifics, with the growth factor hbEGF found in the human epidermis, wounds may heal up to six times faster than those that are untreated.
Zheng et al., "Interleukin-22 upregulates HBEGF expression in HaCaT cells via JAK2/STAT3 and ERK1/2 signalling," Experimental Dermatology, vol.
For comparison, both marimastat (a broad spectrum ADAM and MMP zinc-binding inhibitor) and INCB84298 (a moderately ADAM17-selective zinc-binding inhibitor) inhibited shedding of each tested EGFR ligand (heregulin, TGFa, HBEGF, AREG, and EGF) in A549 cells almost in an equipotent manner [126].
Genes expressed more highly in OECs were Jagged 1 (JAG1), JAG2, placental growth factor (PGF), endothelial cell-specific molecule 1 (ESM1), neurite growth-promoting factor 2 (MDK), inhibin beta A (INHBA), growth differentiation factor-3 (GDF3), pre-B-cell colony-enhancing factor 1 (PBEF1), endothelin 1 (EDN1), interleukin 32 (IL32), heparin-binding EGF-like growth factor (HBEGF), chemokine (C-X-C motif) ligand 1 (CXCL1), chemokine (C-C motif) ligand 2 (CCL2), CCL14, CCL15, bone morphogenetic protein 2 (BMP2), BMP4, and BMP6, whereas genes expressed more highly in MSCs were wingless-type MMTV integration site family, member 5A (WNT5A), CXCL5, vascular endothelial growth factor (VEGF), CCL20, angiopoietin 1 (ANGPT1), growth differentiation factor 5 (GDF5), and WNT5B (Figure 7).
This stimulating effect of Hbegf on cell cycle progression was earlier observed by other groups [51, 52].
The results of immunoblotting analysis confirmed the changes in gene expression at the protein level because protein levels of CDH1, HBEGF, and KRT13 in arsenical-treated cells and MC-T2 cells (Figure 5) agreed well with the mRNA levels measured by Q-PCR assay (Figure 4A).
In fact, several data indicate that MSCs can provide a local microenvironment that supports tissue regeneration such as angiogenesis and osteogenesis through the secretion of several cytokines including epidermal growth factor (HBEGF), basic fibroblast growth factor (bFGF), platelet-derived growth factor-B chain (PDGF-BB), vascular endothelial growth factor (VEGF), keratinocyte growth factor (KGF), and angiopoietins [9].
For instance, Besner and colleagues have shown that heparin binding epidermal growth factor (HBEGF) is important in regulating the pathogenesis of NEC, in part through determining the extent of enterocyte migration [85].