HBLA

AcronymDefinition
HBLAHuman B Lymphocyte Antigens
References in periodicals archive ?
[section] 1828(c)) to merge Whitney National Bank and Hancock's subsidiary bank, Hancock Bank of Alabama ("HBAL"), Mobile, Alabama, into another subsidiary bank of Hancock, Hancock Bank of Louisiana ("HBLA"), Baton Rouge, Louisiana.
(3) HBLA operates in Louisiana; HBAL operates in Alabama; and Hancock Bank operates in Florida and Mississippi.
Detection ofvirulence genes: Representative amplicons of hblA, hblC and hblD encoding the enterotoxin HBL complex and nheA, nheB and nheC encoding the nonhaemolytic enterotoxin of NHE complex, are shown in Fig.
cereus Gene Primer (5' [right arrow] 3') Amplicon (bp) hblA B component of haemolysin BL 320 HBLA1:GTGCAGATGTTGATGCCGAT HBLA2:ATGCCACTGCGTGGACATAT hblD L1 component of haemolysin BL 430 LIA:AATCAAGAGCTGTCACGAAT L1B:CACCAATTGACCATGCTAAT hblC L2 component of haemolysin BL 750 L2A:AATGGTCATCGGAACTCTAT L2B:CTCGCTGTTCTGCTGTTAAT nheA A component of non-haemolytic ET 500 nheA 344S: TACGCTAAGGAGGGGCA nheA 843A: GTTTTTATTGCTTCATCGGCT nheB B component of non-haemolytic ET 770 nheB 1500S:CTATCAGCACTTATGGCAG nheB 2269A:ACTCCTAGCGGTGTTCC nheC C component of non-haemolytic ET 582 nheC 2820S:CGGTAGTGATTTGCTGGG nheC 3401A:CAGCATTCGTACTTGCCAA Table II.
cereus investigados, 14,3% foram positivos para os tres genes que codificam a hemolisina BL (hblA, hblD e hblC); 55,7% apresentaram um ou dois desses genes e nenhum dos tres genes foi detectado em 25,7% dos isolados.
Molecular cloning and characterization of the hblA gene encoding the B component of hemolysin BL from Bacillus cereus.
All the diarrhoeal enterotoxin producing isolates showed the presence of hbla gene, but hbla gene was not present in any of the non-enterotoxigenic isolates tested in this study.
Interpretation & conclusions: Our findings indicated that hbla gene specific PCR can be employed for differentiation of enterotoxigenic B.
hbla, bceT and entFM responsible for diarrhoeal enterotoxin production in B.
hbla gene specific PCR using primer pair Hb1A1/Hb1A2, yielded amplified product of 834 bp only in 30 enterotoxigenic isolates (Fig.
All our 30 enterotoxigenic isolates were positive to hbla gene specific PCR.