HEPF

AcronymDefinition
HEPFHawaii Energy Policy Forum (University of Hawaii at Manoa)
HEPFHuman Embryonic Pulmonary Fibroblast
HEPFHigher Education Promotion Fund (India)
HEPFHigh-Exposure Plutonium Facility
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
In addition, DNA suitability for the detection of cyclic peptide hepatotoxin genes by using HEPF and HEPR primers was developed to identify potentially microcystin or nodularin in two genus of cyanobacteria.In this papers we used the boiling procedure developed by [10].
Primer Sequence Length GC PCR % products name 5' 3' HEPF TTTGGGGTTAACTTTTTTGGGCATAGTC 28 44 472bp HEPR AATTCTTGAGGCTGTAAATCGGGTTT 26 48 Table 2: The program used in the thermocyler PCR.