HES1


Also found in: Dictionary, Thesaurus, Medical, Encyclopedia.
AcronymDefinition
HES1Hairy/Enhancer of Split
References in periodicals archive ?
Citation: Risa Sueda et al., High Hes1 expression and resultant Ascl1 suppression regulate quiescent vs.
Her team then proceeded to turn the gene for Hes1 completely off, so that the protein is no longer produced in the stem cells.
Assays analyzed in the study Gene symbol Gene product name Gene ID (a) NOTCH1 notch 1 7881 HES1 hes family bHLH transcription factor 1 5192 DLL1 delta like canonical Notch ligand 1 2908 DLL3 delta like canonical Notch ligand 3 2909 Dll4 delta like canonical Notch ligand 4 2910 JAG1 jagged 1 6188 JAG2 jagged2 6189 18SRNA ribosomal 18SRNA 1383 Gene symbol Assay ID (b) NOTCH1 Hs01062014_m1 HES1 Hs00172878 m1 DLL1 Hs00194509 m1 DLL3 Hs01085096_m1 Dll4 Hs00184092 m1 JAG1 Hs01070032 m1 JAG2 Hs00171432_m1 18SRNA Hs99999901_s1 According to the (a) HUGO gene nomenclature committee and (b) Applied Biosystems Life Technologies
Normal esophageal mucosa from surgical specimen and columnar metaplastic samples in the esophageal remnant after esophagectomy were subject to IHC for Notch1 and Hes1. Histological evaluation of esophageal mucosa was done on sections with hematoxylin and eosin staining by independent pathologists.
(2014) Hes1 up-regulation contributes to the development of FIP1L1-PDGFRApositive leukemia in blast crisis.
The primary antibodies included goat polyclonal IgG antibody to Dll1 and rabbit polyclonal IgG antibodies to Hes1, N-cadherin, or E-cadherin (Santa Cruz Biotechnology, USA).
During normal development, RPE cell differentiation is regulated via the canonical Notch signaling pathway [134], with its target gene Hes1 being implicated in the formation of the lens, optic cup, and RPE in early embryos [135].
In [9], there is a biochemistry experiment on mice which has proved that there exists a time lag of about 15 min in the peaks between the mRNA molecules and the proteins of the gene Hes1.
(12) Mutaciones inducidas en varios genescomponentes de la via de senalizacion NOTCH como Jagged2 y Hes1, en modelos animales como el raton, han mostrado alteraciones en el desarrollo de varias estructuras craneofaciales como paladar, dientes, maxilares, base y boveda craneal.
HES1: Forward primer ATCCCGGTCTACACCAGCAA; Reverse primer AAGGTCACCGAGGAG PROBE#20 from Roche Universal Probe Library;
Hawkins et al., "NFIA controls telencephalic progenitor cell differentiation through repression of the Notch effector Hes1," Journal of Neuroscience, vol.
They report that the MyoD and Hes1 proteins that regulate the differentiation of muscle cells are produced in the stem cells in an oscillatory manner--i.e., there are periodic fluctuations in the number of cells produced.