HLRC

AcronymDefinition
HLRCHindustan Lever Research Centre (est. 1967; India)
HLRCHarry Laibstain Rare Coins (est. 1980; Norfolk, VA)
HLRCHouston Land Rover Club (Texas)
HLRCHouse Legislative Resource Center
HLRCHonors Leadership Residential College (Morehead State University; Morehead, KY)
HLRCHuman Rights Law Centre
References in periodicals archive ?
The low prevalence of salmonellae with HLRC has been ascribed to counter selection in the environment (6), an observation corroborated by the difficulty in selecting HLRC mutants in vitro.
To identify mutations responsible for HLRC, the quinolone resistance determining regions (QRDR) of DNA gyrase and topoisomerase IV were determined alter nucleotide sequencing of the corresponding QRDR fragments which were PCR-amplified with the respective pairs of primers: 5'CTGAAGCCGGTACACCGTCG and 5'TCGGCCATCAGTTCGTGGGC for gyrA; 5'TTAT'CGATGCTGCGCGTGCC and 5'TCGCCGCTTTCAGGGCGTTC for gyrB; 5'CGCCTACTTAAACTACTCCA and 5'ATCAGCGTAATCGCCGCTTT for parC; and 5'GACC-GAGCTGTTCCTTGTGG and 5'GCGTAACTGCATCGGGTTCA for parE.
The two cases reported here show that clonally unrelated HLRC strains of S.