HLRC

AcronymDefinition
HLRCHollingworth Lake Rowing Club (UK)
HLRCHindustan Lever Research Centre (est. 1967; India)
HLRCHuman Rights Law Centre
HLRCHarry Laibstain Rare Coins (est. 1980; Norfolk, VA)
HLRCHouston Land Rover Club (Texas)
HLRCHouse Legislative Resource Center
HLRCHonors Leadership Residential College (Morehead State University; Morehead, KY)
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
To identify mutations responsible for HLRC, the quinolone resistance determining regions (QRDR) of DNA gyrase and topoisomerase IV were determined alter nucleotide sequencing of the corresponding QRDR fragments which were PCR-amplified with the respective pairs of primers: 5'CTGAAGCCGGTACACCGTCG and 5'TCGGCCATCAGTTCGTGGGC for gyrA; 5'TTAT'CGATGCTGCGCGTGCC and 5'TCGCCGCTTTCAGGGCGTTC for gyrB; 5'CGCCTACTTAAACTACTCCA and 5'ATCAGCGTAATCGCCGCTTT for parC; and 5'GACC-GAGCTGTTCCTTGTGG and 5'GCGTAACTGCATCGGGTTCA for parE.
The two cases reported here show that clonally unrelated HLRC strains of S.
The protocol uses traditional software diffs (HLRC) to propagate updates to the home node of each page at a release point.
We now describe a minimal set of extensions to the network interface that can be used to remove the need for asynchronous protocol processing from the Base (HLRC) protocol we used in the previous section [Bilas et al.
Again, as in the HLRC SMP system, Cashmere-2L implements a more aggressive software DSM protocol than MGS that is modeled after LRC.