HLRC

AcronymDefinition
HLRCHindustan Lever Research Centre (est. 1967; India)
HLRCHarry Laibstain Rare Coins (est. 1980; Norfolk, VA)
HLRCHouston Land Rover Club (Texas)
HLRCHouse Legislative Resource Center
HLRCHonors Leadership Residential College (Morehead State University; Morehead, KY)
HLRCHuman Rights Law Centre
References in periodicals archive ?
To identify mutations responsible for HLRC, the quinolone resistance determining regions (QRDR) of DNA gyrase and topoisomerase IV were determined alter nucleotide sequencing of the corresponding QRDR fragments which were PCR-amplified with the respective pairs of primers: 5'CTGAAGCCGGTACACCGTCG and 5'TCGGCCATCAGTTCGTGGGC for gyrA; 5'TTAT'CGATGCTGCGCGTGCC and 5'TCGCCGCTTTCAGGGCGTTC for gyrB; 5'CGCCTACTTAAACTACTCCA and 5'ATCAGCGTAATCGCCGCTTT for parC; and 5'GACC-GAGCTGTTCCTTGTGG and 5'GCGTAACTGCATCGGGTTCA for parE.
We start from an HLRC protocol that uses interrupts for protocol processing [Samanta et al.
Again, as in the HLRC SMP system, Cashmere-2L implements a more aggressive software DSM protocol than MGS that is modeled after LRC.