HLy

AcronymDefinition
HLyHumphrey Lyttelton (musician)
HLyHappy Life Year
References in periodicals archive ?
Girls 3/4: 1 Harriet Bridge (HLY) 6.21, 2 Lucy Lindley (HM) 6.22, 3 Ruby Yates (CW) 6.23, 4 Olivia Evans (HLY) 6.27, 5 Sophie Simpson (MT) 6.27, 6 Eleanor Bradley (KF) 6.29, 7 Evy-Mae Bartholomew (KH) 6.31, 8 Amelie Stewart (NT) 6.33, 9 Eve Sutton (HF) 6.40, 10 Amelia Connor (HLY) 6.44, 11 Edie Barrett (KF) 6.45, 12 Elphina Waterman (SCH) 6.46, 13 Sasha Joyce (NS) 6.48, 14 Ella Mallinson (KF) 6.49, 15 Alice Hill (SA) 6.50, 16 Georgina Slater (SA) 6.53, 17 Grace Battye (MT) 6.55, 18 Ella McGlynn (RL) 6.55, 19 Scarlett Taylor (RL) 6.58, 20 Charlotte Knight (SX) 7.01.
Experts believe healthy life years (HLYs) provide a better way to make health comparisons between regions than life expectancy.
16S-rRNA U1 CAGCMGCCGCGGTAATWC 938 M = A o C y W = A o T LI1 CTCCATAAAGGTGACCCT hly A Lis1 GCATCTGCATTCAATAAAGA 174 listeriolysin O Lis2 TGTCACTGCATCTCCG TABLA II RESULTADOS MICROBIOLOGICOS EN LA DETERMINACION DE Listeria spp.
coli with hly, cnf-1 and papC genes, and belonging to (extraintestinal) phylogenetic group B2 (Virulent strain).
ap over the rewing Saturday's hly likely that the n higher than last Just like last seaso West Brom, this win side, who have caus many problems in th feeling that survival secured for Laudrup's Not that the Dane i self to get too carried lofty position.
e hly Set of three cre bins, PS40, BHS Set of three cream laundry bins, PS40, BHS At one time jumper jus chunky kni baskets.
"Olympians and the Olympics are hly respected in Japan and I believe if the International Olympic mmittee were to challenge this ustainable hunt, the Japanese ernment would have to listen and ress the issue if they are to be sidered a modern, respectful nation, thy of host nation status.
The Nawras BlackBerry preA[degrees] paid weekly plan now has an increased data allowance of 500MB for RO2, while the montA[degrees] hly prepaid plan gives customers double the original data with 2GB for RO9 per month.
Scientists have even discovered a 'sweet tooth' gene that makes you predisposed to crave cakes and chocolate, which seems highly hly unfair to say the least.
Here are results from the second set of races for primary schools around the area: Boys 3/4: 1 Max Bardell (MT) 5.57, 2 Dominic Sullivan (KH) 5.57, 3 Jacob Foster (MT) 6.01, 4 Michael Avies (SA) 6.05, 5 Louis Ashby (HLY) 6.05, 6 Sam Crawshaw (HM) 6.10, 7 Sam Brown (KF) 6.11, 8 Max Elvidge (UT) 6.12, 9 Archie Tordoff (KH) 6.15, 10 Tristan Cartwright (SX) 6.18, 11 Alfie Brown (SX) 6.20, 12 Archie Hall (HLY) 6.21, 13 William Robinson (HLY) 6.22, 14 Samuell English (BH) 6.23, 15 Harry Knight (SX) 6.26, 16 Alfie Dunne (KH) 6.28, 17 Thomas Moorhouse (SK) 6.29, 18 Cain Bower (HF) 6.30, 19 Jacob Schoolar (HLY) 6.31, 20 Max Wojarski (SA) 6.31.