HMBS


Also found in: Wikipedia.
AcronymDefinition
HMBSHECM (Home Equity Conversion Mortgage) Mortgage-Backed Security
HMBSHeart, Mind, Body and Soul
HMBSHis/Her Majesty’s Bahamian Ship
HMBSHer Majesty's Bermudian Ship
HMBSHer Majesty's Burmese Ship
HMBSHundred Meter Breast Stroke
HMBSHead's Message Board System
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
The first HMB of the DF and the Midwest region was founded in 1978 at Hospital Regional de Taguatinga (HRT), in partnership with Fundacao Hospitalar do DF with the Rotary Clube Taguatinga Norte.
The Rotary's involvement in the establishment of HMBs in the Philippines was sort of a 'fortunate accident,' according to Rene Cantos, past president of the Rotary Club of Timog.
A novel multiplex RT-qPCR assay was developed for KRT19, EpCAM, CDH1, and HMBS gene transcripts.
The mammalian HMBS gene endogenous internal control was positive for all samples, indicating that DNA extraction had been successful.
Gene Forward Reverse Sirt1 GTTGATTGTGAAGCTGTTCGTG TGGCTCTATGAAACTGTTCTGG Pgc-1[alpha] CACCAAACCCACAGAAAACAG GGGTCAGAGGAAGAGATAAAGTTG Hmox-1 GTTCAAACAGCTCTATCGTGC TCTTTGTGTTCCTCTGTCAGC Gclc CTCCAGTTCCTGCACATCTAC AGAACATCGCCTCCATTCAG Sod1 AAGACTGGAAATGCTGGGAG GGTTTGAGGGTAGCAGATGAG Tbp TTCTCGAAAGAATTGCGCTGT GCCTTGTGAGTCATTTCAGTGA Hmbs AAGGGCTTTTCTGAGGCACC AGTTGCCCATCTTTCATCACTG Hmbs: hydroxymethylbilane synthase; Hmox/1: heme oxygenase/1; Gclc: glutamate/cysteine ligase catalytic subunit; Pgc/1[alpha]: peroxisome proliferator/activated receptor gamma coactivator/1/alpha; Sirt1: sirtuin 1; Sod1: Cu/Zn superoxide dismutase; and Tbp: TATA box binding protein.
Intramedullary HMBs can give rise to motor and sensitive deficits related to the tumour characteristics, such as the location, size, syringomyelia, and peripheral oedema, despite their benign histologically features.5 Haemorrhage due to a spinal cord HMB is rare and generally is a subarachnoid haemorrhage.6
(12.) Silva AF, Schieferdecker MEM, Rocco CS, Amarante HMBS. Relacao entre estado nutricional e atividade inflamatoria em pacientes com doenca inflamatoria intestinal.
This has stimulated the concept of community-based HMBs (CBHMBs), which operate outside a health facility, in locations such as homes for orphans or other community centres.
where [g.sub.a] denotes the power amplifier of the HMBs, [k.sub.s] is the proportional gain of the displacement sensor, [l.sub.s] is the distance from the geometric center of the rotor to the sensor, and [tau] is the control system delay.
Quantitative PCR for VDR and the housekeeping HMBS (hydroxymethylbilane synthase) gene primers were as follows: 5'-GAAGCCTTTGGGTCTGAAGTG-3' (VDR forward), 5'-CCGCCATTGCCTCCATCC-3' (VDR reverse) and 5'-GGCAATGCGGCTGCAA-3' (HMBS forward), 5'-GGGTACCCACGCGAATCAC-37 (HMBS reverse).