HMGC

AcronymDefinition
HMGCHuman and Molecular Genetics Center (est. 1999; Medical College of Wisconsin)
HMGCHeaton Moor Golf Club (England)
HMGCHydro-Membrane Gas Chromatography
HMGCHepatic Metastasis of Gastric Cancer (obstetrics and gynecology)
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
HMG-CoA reductases are key enzymes in lipid metabolism, including HMG Coenzyme A reductase a (hmgcra), HMG Coenzyme A reductase b (hmgcrb), and 3-hydroxy-3-methylglutaryl-CoA synthase (hmgcs), mainly regulating genes related to cholesterol synthesis [14, 17, 28].
Gene FP sequence (5'-3') RP sequence (5'-3') cyp2y3 tattcccatgctgcactctg aggagcgtttacctgcagaa cyp3a65 aaaccctgatgagcatggac caagtctttggggatgagga hmgcra ctgaggctctggtggacgtg gatagcagctacgatgttggcg hmgcrb cctgttagccgtcagtgga tctttgaccactcgtgccg hmgcs ctcactcgtgtggacgagaa gatacggggcatcttcttga fasn gagaaagcttgccaaacagg gagggtcttgcaggagacag fads2 tcatcgtcgctgttattctgg tgaagatgttgggtttagcgtg chop aggaaagtgcaggagctgac ctccacaagaagaatttcctcc gadd45[alpha]a tggctttgtttgtgggactt tggaaaacagtccactgaga edem1 gacagcagaaaccctcaagc catggccctcatcttgactt rpp0 ctgaacatctcgcccttctc tagccgatctgcagacacac Table 2: Hesperidin treatment improved alcohol metabolism in zebrafish larvae.
[76] found that, following supplementation with green tea extract powder and eriodictyol for 8 weeks, body weight, food intake, cholesterol levels, and LDL levels were decreased, accompanied by the suppression of two kinds of cholesterol synthesis enzymes, 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMGCR), and 3-hydroxy-3-methylglutaryl-coenzyme A synthase (HMGCS).