HMSF

AcronymDefinition
HMSFHistorical Museum of South Florida
HMSFHannover Messe Sodeks Fuarcilik (Istanbul, Turkey)
HMSFHour/Minute/Second/Frame
HMSFHalf Moon Sober Festival (New Hampshire)
HMSFHuman Marrow Stromal Fibroblast
References in periodicals archive ?
Further, HMSF supports Friends of Cabrillo Marine Aquarium, the nonprofit that provides funding and resources to help the city-run Aquarium meet its mission "to be a trusted resource that inspires exploration, respect and conservation of Southern California marine life."
Gene Sequence (5' [right arrow] 3') HmsF (chromosomal pgm locus) Forward CGGAGAAGCCAACGTTCGT Reverse TCTTTCACTTTGCGGCAATG Probe (MGB) CCGCCTGCACAACG F1 (pMT1) Forward TTGGCGGCTATAAAACAGGAA Reverse CACCCGCGGCATCTGTA Probe (MGB) CACTAGCACATCTGTTAAC Pst (pPCP1) Forward CGGCAATCGTTCCCTCAA Reverse GGTCAGGAAAAAGACGGTGTGA Probe (MGB) AACCATGACACGGTAGACT VAg (pCD1) Forward CGGCGGTTAAAGAGAAATGC Reverse CATCGCCGAATACACAATGG Probe (MGB) TACTGCCATGAACGCC Table 2: A tabular summary of the murine data for each of the challenge experiments described.