HPRT


Also found in: Medical.
AcronymDefinition
HPRTHypoxanthine Phosphoribosyltransferase
HPRTHarvard Program in Refugee Trauma (Massachusetts General Hospital; Cambridge, MA)
HPRTHydraulic Power Recovery Turbine
HPRTHypothalamic-Pituitary Radiation Therapy
HPRTHighest-Priority Range Table
References in periodicals archive ?
Hypoxanthine guanine phosphoribosyltransferase (HPRT) mutations in the Asian population.
Abbreviations AFT: Autonomic function test Amp: Amplitude DPN: Diabetic peripheral neuropathy HPRT: Hypoxanthine phosphoribosyl transferase IENF: Intraepidermal nerve fibers I-E difference: Mean difference of maximal inspiratory and minimal expiratory heart rate NCV: Nerve conduction velocity SPK: Simultaneous pancreas and kidney transplantation VEGF: Vascular endothelial growth factor VPT: Vibration perception threshold VR (Valsalva ratio): Maximal to minimal heart rate during and following the Valsalva maneuver 30:15 ratio: Ratio of heart rates around the 15th and 30th heart beats following standing up [DELTA]Ct: Difference in [Ct.sub.q] values [DELTA] sBP: Difference in systolic blood pressure while supine and at 1 min after standing up.
Table 1 Gene Forward Reverse HPRT GATTAGCGATGATGAACCAGGTT CCTCCCATCTCCTTCATGA CA PT (prothrombin) CCGAAAGGGCAACCTAGAGC GGCCCAGAACACGTCTGTG FX (factor X) GTGGCCGGGAATGCAA AACCCTTCATTGTCTTCGTTAATGA PAR1 TGAACCCCCGCTC ATTCTTTC TGAACCCCCGCTC ATTCTTTC EPCR ATGTGGCCGTGAATGGAAGCGC CCATCAGGATGCCCAGGACC TNF[alpha] GACCCTCACACTCAGATCATCTTCT CCTCCACTTGGTGGTTTGCT IL1[beta] CTGGTGTGTGACGTTCCCATTA CCGACAGCACGAGGCTTT CCL2 CCGGCTGGAGCATCCACGTGT TGGGGTCAGCACAGACCTCTCTCT CXL9 TCCTTTTGGGCATCATCTTCC TTTGTAGTGGATCGTGCCTCG CCL1 CACAGGGGCGCCTATCGCCAA CAAGGCAAGCCTCGCGACCAT
Runs were performed on a ViiA7 Real-time PCR System (Thermo Fisher, USA), and mRNA data were normalized to HPRT mRNA expression using [2.sup.-[DELTA]Ct].
Quantitative real-time PCR was performed, with or without preamplification procedure, on ABI PRISM 7500 SDS (Applied Biosystem) using specific 6-carboxyfluorescein (FAM)-labeled TaqMan assays for SIRT1, Utrn, SOD1, SOD2, CAT-1, Gpx1, GCLC, GCLM, NQO1, HO-1, IL-6, TNF[alpha], IL-1[beta], IL-10, IL6r[alpha], and Hprt as housekeeping genes (Applied Biosystem).
For example, MWCNT caused genotoxic injury in different cell lines, leading to the induction of high mobility group box-1 protein (HMGB1), reactive oxygen species (ROS), or hypoxanthine-guanine phosphoribosyl transferase (HPRT) mutations [1].
Hypoxanthine guanine phosphoribosyltransferase (HPRT), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were used as housekeeping gene and data were normalized relative to the expression level of the HPRT gene.
Hypoxanthine-guanine phosphoribosyltransferase (HPRT) deficiency: LeschNyhan syndrome.
Relative expression levels were calculated using the delta-delta Ct method, using 3-UTR sequences from hprt (hypoxanthine-guanine phosphoribosyltransferase; expression of which was not affected by the experimental treatments), as a reference for normalization.
Congenital diseases may also give rise to hyperuricemia, recessive disorders involving the overproduction of uric acid due to complete or partial lack of hypoxanthine phosphoribosyl-transferase (HPRT) [18], which acts to salvage purines from degraded DNA, taking intracellular hypoxanthine to inosine monophosphate (IMP) and xanthine to xanthine Monophosphate (certain isozymes), and a deficiency or absence of this enzyme results in elevated concentrations of XOR substrates in the cell [19, 20].