HTNF

AcronymDefinition
HTNFHuman Tumor Necrosis Factor
HTNFHumboldt-Toiyabe National Forest (Nevada)
HTNFHill Tracts NGO (Non-Governmental Organization) Forum
References in periodicals archive ?
Gene Forward (5- 3) Reverse (5- 3) hTNF gaggccaagccctggtatg cgggccgattgatctcagc hIL-1b atgatggcttattacagtggcaa gtcggagattcgtagctgga hIL-10 gactttaagggttacctgggttg tcacatgcgccttgatgtctg hIL-12p40 gcggagctgctacactctc ccatgacctcaatgggcagac hGAPDH acgaccccttcattgacc agacaccgatagactccacg mTNF caggcggtgcctatgtctc cgatcaccccgaagttcagtag mIL-1b gaaatgccaccttttgacagtg tggatgctctcatcaggacag mIL-4 ccccagctagttgtcatcctg caagtgatttttgtcgcatccg mIL-10 gtgaaaataagagcaaggcagtg attcatggccttgtagacacc mIFNg agcggctgactgaactcagattgtag gtcacagttttcagctgtataggg mGAPDH tcaacagcaactcccactcttcca acctgttgctgtagccgtattca