HaCaT

AcronymDefinition
HaCaTCultured Human Keratinocyte (cells)
References in periodicals archive ?
It utilizes genetically-modified HaCaT carrying a reporter gene for luciferase under the control of an antioxidant-response element, thus monitoring the activity of Nrf2 transcription factor that accumulates in the nucleus of cells following protein modification by sensitizers (Emter et al., 2010; Andreas et al., 2011).
The HaCaT cells and human fibroblasts (skin from healthy patient) were kindly donated by the Tissue Engineering and Cellular Therapies group (GITTC) from University of Antioquia.
Human epidermal keratinocyte cell line HaCaT was obtained from CLS Cell Lines Service (Germany).
Several studies have suggested that STAT3 promotes the cell cycle, and the inhibitions of STAT3 phosphorylation or phosphorylated STAT3 translocation may be related with accumulation of cells in the G1 or G2/M phase in normal human KCs or HaCaT cells.[15],[19] In the present study, STAT3 siRNA induced an altered cell cycle distribution of psoriatic KCs showing increases in G2/M-phase population and no significant alterations in G0/G1-phase and S-phase populations.
Astragalin can be a novel anticancer agent for the cure and prevention of UVB-stimulated actinic keratosis skin lesion by suppressing phospho-MSK1, [gamma]-H2AX, and p38MAPK activation in a time-and dose-related manner in human HaCaT cells in vitro and Babl/c mice in vivo.
Hwang, "Fucosterol inhibits matrix metalloproteinase expression and promotes type-1 procollagen production in UVB-induced HaCAT cells," Photochemistry and Photobiology, vol.
Human melanoma cell lines were obtained from Bioresource Collection and Research Center (Taiwan): A2058 (BCRC number 60039), A375 (BCRC number 60263), HaCat (human skin keratinocytes) were cultured in Keratinocyte-SFM (Gibco, USA) supplemented with bovine pituitary extract and human recombinant epidermal growth factor [16].
cDNAs from HaCaT cells encoding the SMC domain in Nesprin-2 (AAN60443, aa 1436-1766, and SRs 11-13) were used as PCR templates using the primers for the following: 5' GAATTCAATGAACTCCTTAAAAATATTCAAGATGTG 3', rev: 5' GAATTCCTCGAGGGATTCAGTCATCCCGATCTGGGTCTTGG 3' that contain EcoRI restriction sites for cloning into pGEX-4T1 (Amersham) yielding pGEX-4T1-Nesprin-2-SMC which encodes GST-Nesprin-2-SMC.
HaCat cells derived from human KCs (AddexBio, San Diego, CA, USA) were grown in DMEM 4.5 g/L glucose medium containing penicillin, streptomycin, 2 mM L-glutamine, and 10% FBS.
En pacientes con eczema cutaneo, los cuales son mas susceptibles a infecciones cutaneas severas, entre ellas la causada por el virus de la Varicela Zoster (VZV), se demostro actividad antiviral de la LL-37 y la hBD-2, al disminuir la replicacion del VZV en lineas celulares de keratinocitos HaCaT y en celulas B (7).