HGF


Also found in: Medical, Wikipedia.
AcronymDefinition
HGFHepatocyte Growth Factor
HGFHermann von Helmholtz-Gemeinschaft Deutscher Forschungszentren (Hermann Von Helmholtz Association of National Research Centres)
HGFHead Gasket Failure
HGFHuman Growth Foundation
HGFHybridoma Growth Factor
HGFHarold Grinspoon Foundation
HGFHereditary Gingival Fibromatosis
HGFHyperglycemic-Glycogenolytic Factor
HGFHousing Guarantee Fund Ltd.
HGFHermite Gaussian Function
HGFHousehold Goods Forwarders Tariff Bureau
HGFHandling Gear Fixture
HGFHead of Global Finance
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
HGF provides insurance for aviation professionals to protect against the financial consequences of loss of license and training expenses after a bodily injury or illness.
In this group the calves received colostrum at 10% LBW for three days, then milk was fed at 10% LBW for 4 days, then milk feeding at 10% LBW + CSR for 23 days, milk feeding at 10% LBW + CSR + hay for 20 days, milk feeding at 5% LBW + CSR + hay for 10 days, and finally milk was fed for the next 10 days at 2.5% LBW + CSR + HGF.
Nexus Group, a specialty managing general agent (MGA), has said that it has acquired pilot-insurance provider, Hiscox Global Flying (HGF).
The cytotoxic effects of flowable composites on HGF cell culture, were evaluated using the direct contact test method and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay.
When introduced into the body, HGF protein is expressed from VM202 and induces the formation of new blood vessels, suppresses levels of selective pain mediators, supports regeneration/repair of damaged peripheral nerves, and ameliorates atrophic condition of skeletal muscle.
The expression level of HGF mRNA, which is a well-studied activation factor for satellite cells, was significantly increased in the Precon group at 2 and 4 days after damaging ECC (Figure 3(a)).
Sequences of the mouse gene-specific primers used were listed as follows: [beta]1-actin: forward, AGACAG GGGCCTTTTTGCTAC, reverse, AATTCGCCGGAGAC ACTCG; Bax: forward, AACAGGGGCTTTACGTTCACT, reverse, CGTCCCTTTATAGCTGCCTCC; Bcl-2: forward, AGCCCTGTGCCACCATGTGTC, reverse, GGCAGGTTT GTCGACCTCACT; HGF: forward, AACAGGGGCTTTAC GTTCACT, reverse, CGTCCCTTTATAGCTGCCTCC; MM P-9: forward, GGACCCGAAGCGGACATTG, reverse, CGT CGTCGAAATGGGCATCT.
Hepatocyte growth factor (HGF) is another molecule inducing tumor angiogenesis [36].
MET is expressed predominately on epithelial cells and is a high-affinity receptor for only one known ligand, hepatocyte growth factor (HGF) or scatter factor [115, 116].
But it wasn't known how HGF itself became activated.
A growing body of evidence indicates the HGF (hepatocyte growth factor)/c-met axis as a molecular pathway linked to the control of the cellular redox homeostasis.