HTRA

AcronymDefinition
HTRAHumboldt-Trinity Recreation Alliance (California)
HTRAHuman Trafficking Rescue Alliance
HTRAHigh Time Resolution Astrophysics
HTRAHomeowner Tax Relief Act
HTRAHarding Township Recreation Association (New Vernon, NJ)
HTRAHoofBeats Thoroughbred Racing Association
References in periodicals archive ?
All the sequences generated for the ompA and htrA genes showed 100% identity to sequences from the Rickettsia parkeri strain Portsmouth (GenBank accession no.
The HTRA are keen to work together to demonstrate that young people can make a positive contribution to their area.
Helen Senior of Highland HTRA said: "Since our TRA Award in September we have been working hard as a team and it is a team effort make no bones about it, we have had a successful Halloween night and a successful bonfire night and once a month we have a Sunday breakfast.
Primer Target Nucleotide sequences Product Refe- pairs genes (5' - 3') size rence gltA 1 CS-78 GCAAGTATCGGTGAGGATGTAAT 401 -8 CS-333 GCTTCCTTAAAATTCAATAAATCAGGAT -8 2 CS-239 GCTCTTCTC:ATCCTATGGCTATTAT 834 -8 CS-1069 CAGGGTCTTCGTGCATTTCTT -8 htrA 3 17k-5 GCTTTACAAAATTCTAAAAACCATATA 549 -8 17k-3 TGTCTATCAATTCACAACTTGCC -8 ompA 4 Rr190.
Amplification of the htrA gene fragment of identical size and with identical sequences also confirmed the presence of DNA specific for B.
paragraph]) Detected by 16S rRNA and by htrA amplification.
henselae DNA was detected by using PCR with specific primers for the 16S-23S rRNA intergenic spacer (9) and the htrA gene (10), and the 16S rRNA genotype was confirmed by partial sequencing of the 16S rRNA gene (11).
Analysis of sequences obtained from the htrA gene fragments (434 bp) amplified from both samples showed 99% identity with spotted fever group Rickettsia sequences, including the R.
Molecular characterization of the agent was performed by DNA sequencing of portions of the rickettsial genes gltA, htrA, ompA, and ompB.