IFNT

AcronymDefinition
IFNTInternational Finance Corporation Notes
References in periodicals archive ?
The isolated trophoblastic cells had normal shape and superior trophoblast quality, indicated by increased expression of trophoblast markers IFNT, KRT8, and CDX2 compared to cells isolated on MEFs.
Caption: Figure 3: (a) RT-PCR analysis using primers specific for interferon tau (IFNT), keratin-8 (KRT8), and homeobox protein (CDX2) expression in trophectoderm colonies.
Gene Primer sequences (5,-3;) Annealing Fragment temperature size (bp) ([degrees]C) IFNT F: TCCATGAGATGCTCCAGCAGT 60 103 R: TGTTGGAGCCCAGTGCAGA CDX2 F: GCCACCATGTACGTGAGCTAC 60 140 R: ACATGGTATCCGCCGTAGTC KRT8 F: CACCAGTTCCAAGCCTGTGG 55 176 R: TCAGGTCTCCTGTGCAGATGC GAPDH F: GGCGTGAACCACGAGAAGTA 60 119 R: CCCTCCACGATGCCAAAGT Gene GenBank accession number IFNT X65539 CDX2 DQ126146 KRT8 NM_001033610.1 GAPDH NM_001034034.1
In fact, ISG and MX are up-regulated in the ovine uterus in response to IFNT (Charleston and Stewart, 1993; Ott et al., 1998; Johnson et al., 1999).
Specific antibodies for IFNT and His were used to detect recombinant proteins produced by the 3 expression vectors via western blot (Figure 2B, C).
IFNT from a blastocyst (d 15 to 16 after breeding in cattle) clearly alters endometrial gene expression, allowing the establishment of pregnancy in ruminant ungulates (Spencer and Bazer, 2004).
A comprovacao da saida de IFNT do utero, pela veia uterina, sugere que sua acao endocrina pode estar relacionada a um mecanismo complementar ao mecanismo intrauterino de reconhecimento materno da gestacao.
Apos seu sequenciamento (IMAKAWA et al., 1987), foi renomeada IFNT (ROBERTS et al., 1989; ROBERTS et al., 1992), devido a sua semelhanca estrutural com os interferons tipo I.
The high acetylation and low methylation (euchromatin) status of histone proteins has recently been shown to be required for IFNT gene transcription (Sakurai et al., 2009; 2010).
Levels of OCT4 and CDX2 as well as CREBBP, JUN, ETS2 and IFNT mRNAs in peri-implantation conceptuses were examined by PCR using specific primers (Table 1).
Production of IFNT ceases by d 21 of pregnancy in sheep as trophoblast giant BNC differentiate from the mononuclear trophoblast, but only mononuclear trophoblast cells adhere to uterine LE.
An essential signal produced at a precise time and in adequate amounts to allow maintenance of CL function and continued production of P4 is IFNT (Bazer et al., 2010) which is the candidate molecule for pregnancy recognition associated with CL maintenance (Short et al., 1991).