IMIF

AcronymDefinition
IMIFInternational Maritime Industries Forum (London, UK)
IMIFInternational Music Institute and Festival (Baltimore, MD)
IMIFIsrael Mobile Internet Forum
IMIFInternal Memory Interface
IMIFInitial Modification Interface
IMIFInformed Market Intelligence Forums (Analysts In Media, Inc.)
IMIFInteractive Model of Identity Formation (Postmes, Swaab, & Haslam)
IMIFIllinois Metropolitan Investment Fund
IMIFIntelligent Multimodal Information Fusion
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
dev Skewness Kurtosis Spot -0.000283 0.006187 -0.227774 4.529064 Futures (IMIF) -0.000293 0.006295 -0.026827 4.769744 CSI300 index Jarque-Bera Hurst index Spot 63.74512 0.6485 Futures (IMIF) 78.50241 0.6454 TABLE 2: Comparison of the effectiveness results of in-sample hedging.
Primer sequences used in this study Primer Sequence (5'-3') Gene Reference Carbapenemases GESF ATGCGCTTCATTCACGC [bla.sub.GES] 17 GESR GCTCAGGATGAGTTGTG [bla.sub.GES] 17 IMIF ATTGACACTCCATTTAC [bla.sub.IMI-1] 18 IMIR AACAACCAGTTTTGC [bla.sub.IMI-1] 18 NDMF GGTTTGGCGATCTGGTTTTC [bla.sub.NDM-1] 19 NDMR CGGAATGGCTCATCACGATC [bla.sub.NDM-1] 19 OXA48F CGTGTATTAGCCTTATCG [bla.sub.
But central banks and international financial institutions such as the IMIF and The World Bank still possess between 35,000 and 37,000 tonnes in their vaults -- representing 15-18 years' global mine production at current levels.