IPAH

AcronymDefinition
IPAHIdiopathic Pulmonary Arterial Hypertension
IPAHInternet Protocol Authentication Header
IPAHIdiopathische Pulmonal Arterielle Hypertonie (German: Idiopathic Pulmonary Arterial Hypertension; cardiopulmonary medicine)
IPAHInvasion Plasmid Antigen H Gene
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
Employment by underlying lung disease after the lung transplantation (LT) performed in Poland in 1996-2017--the study by the Silesian Center for Heart Diseases in Zabrze, Poland Patients after LT (N= 67) Underlying lung disease [%] p employed unemployed (N = 20) (N = 47) Chronic obstructive pulmonary 15 20.9 0.797 disease (COPD) Idiopathic pulmonary fibrosis (IPF) 10 18.6 0.572 Cystic fibrosis (CF) 40 16.3 0.053 Idiopathic pulmonary arterial 20 18.6 0.797 hypertension (IPAH) Interstitial lung disease (ILD) 15 25.6 0.531 Table 4.
Marikina City Police said the sting operation stemmed from a report where Ipah and Gerry were allegedly involved with illegal drug peddling activities.
Comparando o crescimento entre os periodos, observase que o periodo de 2010-2011 foi o que teve maior crescimento em todas as classes de tamanho de clareiras (pequenas IPAH de 304,02 cm; medias IPAH de 357,56 cm; e grandes IPAH de 294,65 cm) (Figura 3).
CBLN2 rs2217560 G allele was associated with an increased risk of 1.97 in a GWAS for iPAH and fPAH,[2] which is in consistent with our result ( OR = 1.951, 95% CI = 1.116-3.412, P = 0.019).
A study analyzing whether alterations in DNA methylation pattern could be associated to BMPR2 mutations in 28 patients with iPAH and 27 patients diagnosed with PAH associated with other diseases found no difference in the methylation CpG islands of BMPR2 promoter region between the PAH patients and healthy control subjects (46).
Gel electrophoresis of amplified (eaeA, bfpB, aggR, astA, pic, hly, stx1, stx2 invE, ipaH, elt estIa, estIb) genes, the product size (482, 910, 400, 102, 1, 111, 688, 244, 324, 766, 437, 655, 157, 171 (bp) respectively), of E.coli strains using conventional PCR.
[17] indicated that bosentan was likely to be a more potential cost-effective first-line therapy for UK patients over the lifetime with iPAH or PAH-CTD within FC III than palliative care, with less costly (IPAH $216808.07 versus $328448.05 per patient; PAH-CTD $100314.18 versus $152089.25 per patient, adjusted to the year 2017 value) and better outcomes in QALYs (IPAH 3.32 versus 2.95; PAH-CTD 1.36 versus 1.21).
In attempting to understand the mechanistic basis of this species-dependent sex-bias paradox (higher incidence of IPAH in women, but greater susceptibility to PAH in male mice and rats, with exogenous estrogens having a protective effect) [9-18], we discovered that smooth muscle cells (SMCs) in obliterative IPAH lesions in humans had a marked reduction in levels of the sex-responsive transcription factors STAT5a and STAT5b (collectively either "STAT5a/b" or "STAT5"), their activated Tyr-phosphorylated entities (PY-STAT5), and a downstream sex-responsive target of STAT5--the "broad-spectrum" transcriptional repressor B-cell lymphoma 6 protein (BCL6) (Figure 1) [19-21].
miR-98, which is reduced in endothelial cells of patients suffering from idiopathic pulmonary hypertension (IPAH) and of mouse models of this disease, directly targets endothelin-1 (ET1).
Idiopathic pulmonary arterial hypertension (IPAH) is an uncommon disorder in childhood with an incidence of 0.48 cases per million children per year and a prevalence of 2.1 cases per million, based on the United Kingdom registry [1].
Peak V[O.sub.2] in CPET is a widely used variable and has proved to be useful in diagnosing and evaluating IPAH patients [5, 6].
F:ACTGGCGTTATCCCTTTCTCTGGTG hisJ R:ATGTTGTCCTGCCCCTGGTAAGAGA Shigella spp F:TGTATCACAGATATGGCATGC ipaH R:TCCGGAGATTGTTCCATGTG E.