IRF1


Also found in: Dictionary, Thesaurus, Medical, Financial, Encyclopedia.
AcronymDefinition
IRF1Interferon Regulatory Factor 1
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
Significant correlations among the protein levels of PDL1, eIF2[alpha], and ATF4 and between those of IRF1 and PDL1 were observed in the tumor tissues of both subgroups and in the normal tissue of SCC.
This variable highly correlated (absolute value > 0.15) with PPIA (1.11), TLR8 (0.70), TSG101 (0.49), CUL5 (0.40), Slurp1 (0.32), TLR4 (0.26), HLA-B (0.25), CXCR6 (0.18), TLR9 (-0.17), IDH1 (-0.20), HLA-A (-0.22), IRF1 (-0.24), NCOR2 (-0.24), TRIM5a (-0.30), HLA-C (-0.33), CXCR1 (-0.40), MYH9 (-0.50), and ZNRD1 (-0.91).
In this study, investigators Tomasz Kordula, Ph.D., and Sarah Spiegel, Ph.D., members of the Cancer Cell Signaling research program at Massey and professors in the Department of Biochemistry and Molecular Biology at the VCU School Medicine, found a new signaling pathway that links IL-1 to IRF1 in sterile inflammation.
Michael et al., "Human serum from patients with septic shock activates transcription factors STAT1, IRF1, and NF-[kappa]B and induces apoptosis in human cardiac myocytes," Journal of Biological Chemistry, vol.
The following primers were used: IL-6, forward: TGCCAGC-CTGCTGACGAAGC, reverse: TGCCGAAGAGCCCTCAGGCT, IRF1, forward: AGTCGAGGCAAGACGTGCGCC, reverse: AGAAGGCAGAG-GTMCCGGGTT, NF-KBI, forward: ACTGCCAACAGCAGATGGCCCA, reverse: GCACCAGGTAGTCCACCATGGGAT, IL-18, forward: TCCCCAGCTTGCTGAGCCCTT, reverse: GTTGGCAGCCAGGAGGGCAA, TNFSF10, forward: AGCAGCTCACATAACTGGGACCAG, reverse: TGCGGCCCAGAGCCTTTTCAT, PTGS2, forward: TGAGCGTCAGGAGCACGTCCA, reverse: CTGAGGGCGTCTGGCTGTGG and BCL2, forward: AGCGTCAACCGGGAGATGTCG, reverse: ACAAAGGCATCCCAGCCTCCGTT.
DNA microarray analysis of several genes known to be strongly regulated during gastrointestinal inflammation, combined with quantitative real-time PCR (qRT-PCR) revealed that the apple juice extract AE04 (100-200 microg/mL) significantly inhibited the expression of NF-kappaB regulated proinflammatory genes (TNF-alpha, IL-1beta, CXCL9, CXCL10), inflammatory relevant enzymes (COX-2, CYP3A4), and transcription factors (STAT1, IRF1) in LPS/IFN-gamma stimulated MonoMac6 cells without significant effects on the expression of house-keeping genes.