Also found in: Wikipedia.
IROBIndustrial Relations and Organisational Behaviour (UK)
IROBIn Range Out of Building (telephone device)
Copyright 1988-2018, All rights reserved.
References in periodicals archive ?
PCR conditions for iroB were the same as those used in iucA but the annealing temperature was 55[degrees]C.
Four strains were identified as probable hvKP based on being positive for either iucA, or iroB gene.
PCR design and troubleshooting was reviewed and each student performed PCR amplification of iroB utilizing primer iroB F1: TGGACTGCTATACCCTGTGC and primer iroB R1: GCAGTATGCTCATGCTGGGC which yields a 493bp PCR fragment.
Rapid detection of Salmonella enterica with primers specific for iroB. J Clin Microbiol 1997 May; 35(5):1224-30.
He says it will be up to the border commission to rule on an issue that has threatened to sabotage the TSZ: Ethiopia's determination to keep troops stationed at Irob, an area north of the demilitarisation line originally agreed by the UN with the two governments.
The Land Rover 4x4 in Schools Technology Challenge World Finals takes place with support from a host of companies including programme co-founder and title partner, Jaguar Land Rover and supporting sponsors, The Institution of Engineering and Technology, Engineering in Motion, Denford Ltd, Harper Adams University and IROB.