IS1


Also found in: Wikipedia.
AcronymDefinition
IS1Information System
IS1Insertion Sequence 1 (biochemistry)
IS1Information Separator 1
IS1Idiopathic Scoliosis
References in periodicals archive ?
Third: Dichotomous variable is1 if the tweet is from a Libertarian, Independent, or Green Party candidate; Republican is the base case.
1, chlorogenic acid; 2, cryptochlorogenic acid; 3, neochlorogenic acid; 4, isochlorogenic acid A; 5, isochlorogenic acid B; 6, isochlorogenic acid C; 7, caffeic acid; 8, hyperin; 9, isoquercitrin; 10, quercetin; 11, campherol; 12, p-coumaric acid; 13, isorhamnetin; 14, rutin; 15, astragalin; 16, apigenin; IS1, catechin; IS 2, gallic acid.
Positive ions were detected in a reflectron mode using the following voltages: IS1 20.12 kV and IS2 17.82 kV; on lenses, 7.47 kV; reflectron, Ref1 21.07kV and Ref2 10.80kV; ions were detected in the range m/z from 120 to 5000 Th and in the linear mode in the range from 2000 to 20,000 Th at the following voltages: on the ion source IS1 20.12 kV and IS2 19.12 kV; on the lenses 4.48 kV.
The element was 100% identical to a chromosomal phage-encoded IS1 from SflV (NCBI number NC022749) located in a P4 prophage region interrupted by genes from other phage sources (Table S1).
The isolated DNA was amplified using specific pairs of primers IS1 (5'CTCGTCCAGCGCCGCTTCGG3') and IS2 (5'CCTGCGAGCGTAGGCGGTGG3') for Mycobacterium tuberculosis complex.
Nitrogen concentration was determined using near infrared spectroscopy (N1R) with a FOSS NIR System 6500 (FOSS Pacific, Mulgrave, Vic., Australia) scanning monochromator in conjunction with Infrasoft International (IS1) software (FOSS Pacific, FOSS Pacific, Mulgrave, Vic, Australia).
These interviewees emphasised that their 'public mandate is not commerciar (IS1) and proclaimed their willingness to receive lower ratings than the commercially oriented channels.
Influencia IS1 As pessoas, que sao Social (IS) importantes para mim, entendem que eu devo utilizar os sistemas de apoio ao conhecimento.
(3.) Wilhelm Ropke, A Humane Economy: The Social Framework of the Market Economy, with a new introduction by Samuel Gregg (Wilmington: IS1 Books, 1958/2014), 219.
[36] combined the use of IMS with monoclonal and polyclonal antibodies and modified IS900 (IS1 PCR) to detect MAP DNA.
This graph explains the relationship between r and d for imaging system IS1 as summarized in Table 1.