IS5

AcronymDefinition
IS5Insertion Sequence 5 (biochemistry)
IS5Intensive Session 5 (summer session code; Indiana University; Bloomington, IN)
References in periodicals archive ?
Tobii AB (STO:TOBII), a provider of eye tracking solutions, announced on Tuesday that Alienware, Dell's PC gaming brand, announced at CES 2019 that its new flagship Alienware Area-51m gaming laptop will be the first consumer product to integrate Tobii's IS5 eye-tracking technology.
WCP's investment banking and domain experts worked closely with iS5's management and board throughout the financing process.
One interviewee revealed, 'We encourage public engagement, for example, by allowing the audience to express themselves on Facebook, and we even show it onscreen, after selection and editing, obviously...' (IS2), while another stated, 'we want different social groups and minorities to have access to the media so we hear their voices...' (IS5).
Resistance genes identified by whole-genome sequencing of an ESBL-producing mcr-1-positive Klebsiella pneumoniae strain isolated from a 38-year-old man, France * Resistance gene Target antimicrobial drug mcr-1 and inactivation of Colistin mgrB by IS5 insertion [bla.sub.SHV-106] [beta]-lactams aac(3)-IId and aadA16-like Aminoglycoside aac(6')Ib-cr Quinolone and aminoglycoside fosA5 Fosfomycin sulI and folP Sulfonamide dfrA27 Trimethoprim tetD Tetracycline * ESBL, extended-spectrum [beta]-lactamase.
IS5. The two parties exchange .87 information frequently with each other.
"I'm still wiping a bottom, making three meals a day, dealing with sass-and also trying to work", said the mother of three kids, namely, Violet who is 8, Seraphina who is5 and Samuel who just turned 2.
Laboratories operating on a limited budget can now quickly obtain high-quality IR spectroscopic data and perform complete mixture analyses using a new attenuated total reflectance (ATR) accessory for the Thermo Scientific Nicolet iS5 FTIR spectrometer from Thermo Scientific, Waltham, Mass.
Thermo's IS5 and PerkinElmer's Spectrum Two, which facilitate their use as components of compact rack-mountable, field-deployable gas analysis systems.
ISSR-PCR analysis of DNA samples extracted from seeds and leaves of interspecific hybrids of foxtail showed that using primers IS2, iS3, and IS5 allowed obtaining relatively high polymorphism DNA that reflects genetic diversity of harvested hybrid forms (see Figure 3A and 3B).
ATR (IR) spectra of MJE, F1, and F3 were recorded on ATR Nicolet IS5 supplied by Thermo Fisher Scientific (Verona Road, Madison, USA) with scanning speed of 1cm/sec and 32 numbers of scans.
Sample Ag at.% Eg Resistivity Carrier ([OMEGA] x cm) concentration ([10.sup.18] [cm.sup.-3]) IS 0 2.82 ~1000 ~1.0 x [10.sup.-5] IS1 0.55 2.77 0.2100 2.311 IS2 1.09 2.67 0.2127 3.615 IS3 1.58 2.72 0.2797 2.752 IS4 1.62 2.70 0.1679 2.241 IS5 1.90 2.73 0.2637 2.424 IS6 2.15 2.70 0.3691 2.655 IS7 3.31 2.69 0.3255 1.419 IS8 4.21 2.69 0.3448 2.289 TABLE 2: Average grain size of the Ag-doped [In.sub.2][S.sub.3] films with different dopant levels.
A product of 984 bp was amplified by using primers IS5 F 5' cggagacggtgcctaagtgg 3' and IS6 R 5' gatggaccgccagggcttgc 3' This amplified PCR product was then further subjected to nested PCR by same primers to further validate the results.