ITSF


Also found in: Wikipedia.
AcronymDefinition
ITSFInternational Table Soccer Federation
ITSFInnovative Technologies from Science Fiction for Space Applications (research study)
ITSFIndonesia Toray Science Foundation (Toray Industries, Inc.)
ITSFInternational Telecom Sync Forum (est. 2001)
ITSFInformation Technology Security Forum (American Petroleum Institute)
ITSFInsulin, Transferrin, Selenium, and Fibronectin (stem cell research)
References in periodicals archive ?
Two primers (ITSF: 5'- GGGTTGTAGCTGGCCTTCCGAGGC ACGT-3' and ITSR: 5-TTATCACACCGAGAGCCGATCCGCAAGG-3') were used for amplification of the ITS1-5.8S-ITS2 region nucleotide sequence, and two primers (FIPA: 5'- ATGTCCGACACTGCCTTGATCTTCAGG-3' and FIPB: 5'-CTAGTTCCACTGGGCGATGATGAAGTC-3') were used for amplification of the FIPs nucleotide sequence.
Oscilloquartz, an ADVA Optical Networking company, announced today that it will showcase vital new functionality for its synchronization and distribution technology at the 2016 International Timing & Sync Forum (ITSF) in Prague.
Were excited to present our latest advancements to the industry at ITSF. Our demos will show that weve created a complete synchronization solution a family of devices that makes precise, resilient and affordable timing available for every industry, commented Gil Biran, general manager, Oscilloquartz.
The development of the new oscillator will be presented on November 4, 2015, in Edinburgh, UK, at the upcoming ITSF 2015 (the International Telecom Sync Forum).
ADVA Optical Networking announced today that it will be hosting multiple seminars at ITSF 2013 on the importance of timing and synchronization assurance in mobile backhaul networks.