ITSR

AcronymDefinition
ITSRIranian Transactions and Sanctions Regulations (US Treasury)
ITSRInformation Technology Strategic Research (US NASA)
ITSRInstitute for Treatment and Services Research (National Development and Research Institutes, Inc.; New York, NY)
ITSRInformation Technology Services Request
ITSRInstitute of Technical and Scientific Research (est. 2014; India)
ITSRInternational Technical Standards and Regulations (International Finance Corporation; Washington, DC)
ITSRImmunization Tracking System Repository
References in periodicals archive ?
G&S Brough had earlier signed an agreement with the Cube developers that would let some of itsr light be obscured while BDC and its partner company Salvage Wharf Limited - which has the same owners and directors as BDC - worked on the development next to the canal.
The report states that China faced increasing workers' demands for higher wages, and saw itsr volume and value fall, although by only 7% and 6% respectively.
Testwork by Sociedad Minera Pudahuel (SMP) in Chile has indicated that itsr Thin-Layer-Bacterial (TL-B) leach process could raise leach recoveries from secondary sulphides from the current 35-40% to an average of 60%, depending on the type of secondary mineralization.
Two primers (ITSF: 5'- GGGTTGTAGCTGGCCTTCCGAGGC ACGT-3' and ITSR: 5-TTATCACACCGAGAGCCGATCCGCAAGG-3') were used for amplification of the ITS1-5.8S-ITS2 region nucleotide sequence, and two primers (FIPA: 5'- ATGTCCGACACTGCCTTGATCTTCAGG-3' and FIPB: 5'-CTAGTTCCACTGGGCGATGATGAAGTC-3') were used for amplification of the FIPs nucleotide sequence.
Tenders are invited for construction of girls hostel and mess hall for itsr chethalayam wayanad
Properties of bituminous mixtures designed for test sections Properties SMA 8 AC 16 HAMAC 16 PA 11 AP AF DE80C 35/50 20/30 50/70 Binder content, % m/m 7.1 4.3 5.5 4.7 7.4 Air voids, % v/v 3.3 3.8 3.8 29.5 2.4 Rutting (large device, 9.2 2.1 3.6 -- -- 60[degrees]C, 10000/ 30000 cycles), % Resistance to water, 92.6 90.2 91.8 -- -- ITSR, % Stiffness (4PB, -- 19 435 16 312 -- 10 052 10[degrees]C, 10Hz), MPa Fatigue (4PB, -- 116 180 -- 279 10[degrees]C, 10Hz), [[epsilon].sub.6], [micro]m/m Table 2.
WIN 1 OF 100 MEALS FOR TWO AT RAVAL Your Chronicle has got together with Raval, recently voted Britain's best Indian restaurant by a group of celebrity chefs, to celebrate the launch of itsr new takeaway service.
Tenders are invited for purchase of audio and video system for the itsr, chethalayam, wayanad.
For the determination of air voids content and Indirect Tensile Strength Ratio (ITSR), three series of each mixture type were prepared (each of series with a different binder content): with a min binder content, with a min plus 0.3% binder content and with a min plus 0.6% binder content.
Tenders are invited for providing tile flooring and safety grills to the balance portion of the building for itsr chethalayam
This granular compound incorporates an adhesion promoter that improves the behavior under indirect traction (ITSR) and therefore the passive adhesion in the mix, making possible the use of different types of aggregates with optimum working conditions.