JBIP

AcronymDefinition
JBIPJohn Belk International Program (Queens University of Charlotte; North Carolina)
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
A set of four LAMP primers (JF3 and JB3, JBIP and JFIP) recognizing six distinct regions in the viral putative DNA helicase gene sequence (GenBank accession KC245087) was designed by using the Primer Explorer version 4 (http://primerexplorer.Jp/elamp4.0.0/index.html).
The reaction mixture (25 [micro]L) contained 1.6 [micro]M each of inner primer (JBIP and JFIP), 0.2 [micro]M each of outer primer (JF3 and JB3), 1mM of dNTP mix, 0.5 M betaine (Sigma, USA), 6 mM Mg[Cl.sub.2], 8 U Bst DNA polymerase large fragment (New England Biolabs, USA), 1x the supplied buffer, and 5 [micro]L template DNA that was heated at 95[degrees]C for 5 min.
Primer Sequence (5' [right arrow] 3') Position JF ATGTGCAACGTGACGGCGAGT 1-21 JR CTACCGTCTTTTAGGG 1446-1431 JF1 TGAAATGTCAAAAGTGGATGG 239-259 JR1 TATTCCCAGACAGCCTTCAAA 954-934 JF2 GAACACCGCTGCTCATCATC 323-342 JR2 ACTCTTCGCAAGTCCTCACC 679-660 JF3 TTGGATCTGAACGCTTCGG 97-115 JB3 CGTTGGTCTGTATGGGAGC 286-304 JFIP GCGATGTAAGCCCTGTGAGACTTTTTACGAGACGT- 176-197/TTTT/116-134 GGTTCCTAGC JBIP AACGCACGAGTGCGAGTCTCTTTTGCTGTGGAT- 204-223/TTTT/254-271 CGTCCATCC