JF3

AcronymDefinition
JF3Joshua Falken Trio (band)
References in periodicals archive ?
JF3: Analyst with an undergraduate degree and over five years of work experience--looking back, I would say that my Caribbean network was impactful to an extent, especially in landing my current job.
For Japanese samples they varied from 47 [+ or -] 1 [micro]Sv [y.sup.-1] (JF3) to 672[+ or -]4 [micro]Sv [y.sup.-1] (JF5) with a mean value of 258 [+ or -] 3 [micro]Sv [y.sup.-1], as shown in Tables 5 and 6 and Figure 3(b).
[I.sub.[gamma]] of the Egyptian samples varied from 1.10 [+ or -] 0.06 for (EF- 5) to 2.96 [+ or -] 0.20 for (EF-1) with a mean value of 2.06 [+ or -] 0.11.For the Japanese samples, it varied from 0.29 [+ or -] 0.03 for (JF3) to 4.26 [+ or -] 0.19 for (JF5) with a mean value of 1.63 [+ or -] 0.08, as can be seen in Tables 5 and 6 and Figure 4(a).
The reaction mixture (25 [micro]L) contained 1.6 [micro]M each of inner primer (JBIP and JFIP), 0.2 [micro]M each of outer primer (JF3 and JB3), 1mM of dNTP mix, 0.5 M betaine (Sigma, USA), 6 mM Mg[Cl.sub.2], 8 U Bst DNA polymerase large fragment (New England Biolabs, USA), 1x the supplied buffer, and 5 [micro]L template DNA that was heated at 95[degrees]C for 5 min.
Primer Sequence (5' [right arrow] 3') Position JF ATGTGCAACGTGACGGCGAGT 1-21 JR CTACCGTCTTTTAGGG 1446-1431 JF1 TGAAATGTCAAAAGTGGATGG 239-259 JR1 TATTCCCAGACAGCCTTCAAA 954-934 JF2 GAACACCGCTGCTCATCATC 323-342 JR2 ACTCTTCGCAAGTCCTCACC 679-660 JF3 TTGGATCTGAACGCTTCGG 97-115 JB3 CGTTGGTCTGTATGGGAGC 286-304 JFIP GCGATGTAAGCCCTGTGAGACTTTTTACGAGACGT- 176-197/TTTT/116-134 GGTTCCTAGC JBIP AACGCACGAGTGCGAGTCTCTTTTGCTGTGGAT- 204-223/TTTT/254-271 CGTCCATCC
The third set of beams in group C, in which the beams were strengthened by strips, that is, U wrapped woven jute FRP in strips, JF3 and JF4, and all strip wrapped strengthened beams were tested to find out their ultimate flexural strength.
While Geneva tots up its new arrivals and frequencies, work continues on the new CHF 100 million JF3 front pier.