JR1

AcronymDefinition
JR1Journal Report 1 (number of successful full-text article requests by month and journal; program of Counting Online Usage of Networked Electronic Resources)
References in periodicals archive ?
Primer Sequence (5' [right arrow] 3') Position JF ATGTGCAACGTGACGGCGAGT 1-21 JR CTACCGTCTTTTAGGG 1446-1431 JF1 TGAAATGTCAAAAGTGGATGG 239-259 JR1 TATTCCCAGACAGCCTTCAAA 954-934 JF2 GAACACCGCTGCTCATCATC 323-342 JR2 ACTCTTCGCAAGTCCTCACC 679-660 JF3 TTGGATCTGAACGCTTCGG 97-115 JB3 CGTTGGTCTGTATGGGAGC 286-304 JFIP GCGATGTAAGCCCTGTGAGACTTTTTACGAGACGT- 176-197/TTTT/116-134 GGTTCCTAGC JBIP AACGCACGAGTGCGAGTCTCTTTTGCTGTGGAT- 204-223/TTTT/254-271 CGTCCATCC
The only COUNTER report available via SUSHI that measures full-text uses is the JR1 report, which counts uses per journal title.
The highest-ranking COUNTER reports (see table on page 8) were JR1 (1.77), DB1 (1.55), and BR1 (1.47) by a margin of 0.40.
Some vendors will include all journals in a JR1 report, whether the library subscribes to the journal or not.
At the bare minimum, offer the JR1, DB1, and (if applicable) BR1 reports.
The team also advised JR1 Entertainments on obtaining an operating licence for remote pool betting.
Warming up for a possible extended mission as it speeds through deep space, NASAs New Horizons spacecraft has now twice observed 1994 JR1, a 90-mile-wide (145-kilometer-wide) Kuiper Belt object (KBO) orbiting more than 3 billion miles (5 billion kilometers) from the sun.
Taken with the spacecrafts Long Range Reconnaissance Imager (LORRI) on April 7-8 from a distance of about 69 million miles (111 million kilometers), the images shatter New Horizons own record for the closest-ever views of this KBO in November 2015, when New Horizons detected JR1 from 170 million miles (280 million kilometers) away.
Combining the November 2015 and April 2016 observations allows us to pinpoint the location of JR1 to within 1,000 kilometers (about 600 miles), far better than any small KBO, he said, adding that the more accurate orbit also allows the science team to dispel a theory, suggested several years ago, that JR1 is a quasi-satellite of Pluto.
Commodities Estatisticas Soja Algodao Cafe Milho Painel A--Teste CHOW & DENNING (1993) CD1 3,733 49,050 4,501 26,671 Painel B--Teste de CHEN & DEO (2006) VR(-1) 0,079 1,433 -0,296 0,965 QPn 12,952 98,489 18,960 113,164 Painel C--Teste de postos e sinais de WRIGHT (2000) JR1 2,716 51,203 5,575 31,485 JR2 3,231 50,985 5,021 30,633 JS1 1,950 41,438 3,840 23,717 * Resultados significativos ao nivel de 5% em negrito.
To control cyclical and secular changes, I also included dummy variables for each year in my sample, as well as dummy variables for the June (issue 2), September (issue 3), and December (issue 4) issues of JR1. March is the excluded category.
In addition to updates to the previous COUNTER reports that administrators have come to rely on (JR1, JR1a, JR3, JR4, CR1 & BR2), HighWire now offers the following COUNTER R4 reports: