JR1

AcronymDefinition
JR1Journal Report 1 (number of successful full-text article requests by month and journal; program of Counting Online Usage of Networked Electronic Resources)
References in periodicals archive ?
Primer Sequence (5' [right arrow] 3') Position JF ATGTGCAACGTGACGGCGAGT 1-21 JR CTACCGTCTTTTAGGG 1446-1431 JF1 TGAAATGTCAAAAGTGGATGG 239-259 JR1 TATTCCCAGACAGCCTTCAAA 954-934 JF2 GAACACCGCTGCTCATCATC 323-342 JR2 ACTCTTCGCAAGTCCTCACC 679-660 JF3 TTGGATCTGAACGCTTCGG 97-115 JB3 CGTTGGTCTGTATGGGAGC 286-304 JFIP GCGATGTAAGCCCTGTGAGACTTTTTACGAGACGT- 176-197/TTTT/116-134 GGTTCCTAGC JBIP AACGCACGAGTGCGAGTCTCTTTTGCTGTGGAT- 204-223/TTTT/254-271 CGTCCATCC
The only COUNTER report available via SUSHI that measures full-text uses is the JR1 report, which counts uses per journal title.
The highest-ranking COUNTER reports (see table on page 8) were JR1 (1.77), DB1 (1.55), and BR1 (1.47) by a margin of 0.40.
Some vendors will include all journals in a JR1 report, whether the library subscribes to the journal or not.
At the bare minimum, offer the JR1, DB1, and (if applicable) BR1 reports.
The team also advised JR1 Entertainments on obtaining an operating licence for remote pool betting.
Commodities Estatisticas Soja Algodao Cafe Milho Painel A--Teste CHOW & DENNING (1993) CD1 3,733 49,050 4,501 26,671 Painel B--Teste de CHEN & DEO (2006) VR(-1) 0,079 1,433 -0,296 0,965 QPn 12,952 98,489 18,960 113,164 Painel C--Teste de postos e sinais de WRIGHT (2000) JR1 2,716 51,203 5,575 31,485 JR2 3,231 50,985 5,021 30,633 JS1 1,950 41,438 3,840 23,717 * Resultados significativos ao nivel de 5% em negrito.
To control cyclical and secular changes, I also included dummy variables for each year in my sample, as well as dummy variables for the June (issue 2), September (issue 3), and December (issue 4) issues of JR1. March is the excluded category.