KRIBB

AcronymDefinition
KRIBBKorea Research Institute of Bioscience and Biotechnology
References in periodicals archive ?
This research was supported by Korea Research Institute of Bioscience and Biotechnology (KRIBB) Research Initiative Program Grants (KGM4241642 and KGM4611613).
(27.) Government research institutes include the Korea Research Institute of Bioscience and Biotechnology (KRIBB), the Korea Research Institute of Chemical Technology, the Korea Institute of Science and Technology (KIST).
This work was supported by grants from the Next-Generation BioGreen 21 Program (PJ01117604) and the Bio-industry Technology Development Program (316037-04-2-HD020) through the Rural Development Administration, the Ministry of Agriculture, Food and Rural Affairs, and the KRIBB Research Initiative Program (KGM4251723), Republic of Korea.
This research was supported by the NRF grant funded by the Ministry of Science, ICT & Future Planning (2012M3A9B6055416), NRF-2014R1A5A2009242, and KRIBB Research Initiative Program.
Standardized aqueous extract of Carthami Flos (Carthamus tinctorius L.; catalog number: CW04-081) was obtained from the plant extract bank at KRIBB (Korea Research Institute of Bioscience and Biotechnology), Daejeon, Korea.
These bacteria were either purchased from the KRIBB Gene Bank or kindly provided by Dr.
Kang in the KRIBB. SV40 polyA was cloned using pCMV-Tag1 vector (Stratagene, USA) as template by PCR using sense primer with additional XhoI site (GTCGACACTCGATCGCCCTT) and antisense primer with additional EcoRI site (GAATTCAATTTACGCGTTAA).
(1) Center for Development and Differentiation, Korea Research Institute of Bioscience and Biotechnology (KRIBB), 111 Gwahangno, Yuseong-gu, Daejeon 305-806, Korea
This work was supported by a research program grant from the Korea Research Institutes of Bioscience and Biotechnology (KRIBB).
In literature, PMI measurements are usually done on female patients (Kribbs, 1990; Knezovic Zlataric et al.; Metzler et al., 2012; Tozoglu & Cakur).
Sixth place finishers were Madison Kribbs (800-meter run); Alex Hennrich (400-meter dash); and Peyton Clendenin (200-meter dash).