LIPE


Also found in: Dictionary, Wikipedia.
AcronymDefinition
LIPEInternational League for Ecological Protection (Guinea-Bissau)
LIPELudwigsburger Initiative Psychiatrie Erfahrener (German: Ludwigsburg Initiative Psychiatric Treatment; Ludwigsburg, Germany)
LIPELaryngospasm Induced Pulmonary Edema (medical condition)
LIPELight Weight IP Encapsulation (IETF)
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
"This was an important bird," concludes Lipe. "Turkeys were one of the things they had to be thankful for."
Real-time PCR was performed as described above using the following sequence-specific primer pairs against target gene promoters: ANGPTL4, F: 5' TGaGcTCTTCTCCGTTCATCTCGAACCAC 3' ,R: 5' GAGTCTAGACATCTCAGAGGCTCTGCCTG 3'; PDK4, F: 5' GGATTTCAACAGCCAGT GCT 3', R: 5' ATAGT GCT GCCCAGT GTGTG 3'; CD36, F: 5' ATTTGTGGTTGGTTGCCAAG 3', R: 5' AGGT GAT GGGT CTT CACCAG 3'; LIPE, F: 5' CAAGTGATTGGGATGAAGCA 3', R: 5' CTAGCCAGCCCAGTCTTCAG 3'; insulin, F: 5' CTTCAGCCCAGTTGACCAAT 3', R: 5' AGGGAGGAGGAAAGCAGAAC 3'.
Craig |Beevers, right, against his opponent Chris Lipe
He finished the fourth game with a score of 440, beating Lipe's 412.
The first experiment I review is "The Balanced Scorecard: Judgmental Effects of Common and Unique Performance Measures" by Marlys Gascho Lipe and Steven Salterio.
This Lipe bag from Dune cheap at pounds 55 will see you through this summer and next.
Eastern Consolidated principal/senior director David Schechtman, Esq., senior director Peter Carillo, directors Louis Ricci, Marion Jones Pavone and Lipe Lieberman with senior financial Analyst Paul J.
and Sue Walker; Buyer: Ralph and Lynda Lipe; Description: Four bed, 1.5 bath, 3,135-square-foot, two story home with waterfront on Lake Chelan; Address: 124 North Park St., Chelan; Price: $1,450,000 Seller: Dennis R.
on a chilly March afternoon when residents of the highland village of Villa Lipe, Bolivia heard the noise.
Goode." Lee Coffee was "The Musical Pumpkin," and Ron Lipe became "Prince Knight." Don O'Day and Jack Davis rounded out the staff.