M2F


Also found in: Medical.
AcronymDefinition
M2FMale to Female (transsexual)
M2FMail to Fax
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
Primer code Target gene Primer sequence PCR product size M1F MAT1-1 ATTGCCCATTTGGCCTTGAA 396 base pairs M1R MAT1-1 TTGATGACCATGCCACCAGA 396 base pairs M2F MAT1-2 GCATTCATCCTTTATCGTCAGC 270 base pairs M2R MAT1-2 GCTTCTTTTCGGATGGCTTGCG 270 base pairs Table 3: Mating type distribution for A.flavus isolates sampled in two counties in Kenya.
The same obviously cannot be said for a M2F transsexual who has not had such surgery, even if the person dresses and acts like a woman, since the presence of a penis and testicles amidst girls who were showering or changing could be very disconcerting - and perhaps even threatening - to say the least, suggests Banzhaf.
M2F Publishing's books will be distributed by Gardner's.
TELECOMWORLDWIRE-30 April 2003-Swivel M2F available now from Swivel Secure(C)1994-2003 M2 COMMUNICATIONS LTD http://www.m2.com
Heshouldhave underfootconditions to suit in the 2 m2f handicap at York on Saturday.
In the case of F2M calls, the negotiated price is only "one way", as the other way (M2F) is typically regulated.
vvResultSt obartD oncaster CupG roup22 m2f 1T imes Up.
vvResultRe dM illsIr ish ChampionS takes1 m2f 1S now Fairy.........