M2R

AcronymDefinition
M2RMaster 2 Recherche (French)
M2RMade 2 Race
M2RM2 Muscarinic Receptor (biomedicine)
M2RM2-Receptor Subtype (neurophysiology)
M2RManufacturer-to-Retailer Marketing Program (Lortz Direct; Omaha, NE)
References in periodicals archive ?
Primer code Target gene Primer sequence PCR product size M1F MAT1-1 ATTGCCCATTTGGCCTTGAA 396 base pairs M1R MAT1-1 TTGATGACCATGCCACCAGA 396 base pairs M2F MAT1-2 GCATTCATCCTTTATCGTCAGC 270 base pairs M2R MAT1-2 GCTTCTTTTCGGATGGCTTGCG 270 base pairs Table 3: Mating type distribution for A.flavus isolates sampled in two counties in Kenya.
M2R, established in 2003, has successfully developed the MicroScreen rotating belt screen filtration technology for applications in municipal and industrial wastewater treatment plants, securing important initial projects with major customers in the United States.
(7) In addition, in one study, 38.8% of DCM patients were found to have M2R autoantibodies.(42) In DCM, "A highly significant correlation was found between the presence of an ti m uscarin ic receptor-2 autoantibodies and anti-beta-adrenoceptor-1 autoantibodies in the patients' sera."(42)
A rapid simple technique utilizing Calcofluor white M2R for the visualization of Dinoflagellate thecal plates.
UK-BASED recruitment company m2r global will hold a free workshop for jobseekers in Bahrain next month.
M2R completed the contract by submitting an initial purchase order to PHE for a 5 tpd UHTG system.
"There are far more candidates than vacancies in the UAE," said Munir Mamujee of recruitment firm m2r. "A standard sales job with an average salary can attract 50 applications daily," he added.
Las larvas de dicho insecto fueron tratadas con el virus solo, obteniendose un porcentaje de mortalidad del 66,3% y cuando las particulas virales se mezclaron con dos de estos derivados del estilbeno (Blankophor BBH y Calcofluor M2R), la mortalidad aumento hasta el 100%.
1057 Steeles Avenue West, Suite 532, Toronto, ON M2R 3X1 Canada
The nucleotide sequence of the small (S) (EU622820) and medium (M) (EU622819) segments of XJ0625 were sequenced by using the primers SF (5'-AGTAGTGTACCCCACTTGAATAC-3'), SR (5'-CAAATGGATTTGATCCTGATGC-3'), M1F (5'-CACAAGTTCCAAGATGATGTT-3'), M1F (5'-CTGTGCCTTCTGCTTGGACTA-3'), M2F (5'-GTCCAAGCAGAAGGCAC AGAT-3'), M2R (5'-GTGGTCACTGTACATTCTCCTGAA-3'), M3F (5'-CACACTTCTGTTTAGCAGATACC-3'), M3R (5'-CTCTAGTCTATAGCTTGCTGGTGTT-3'), M4F (5'-GCACCAATCTGAACGCAATAACAC3'), and M4R (5'-AGTAG TGTGCTACCAAGTATA-3').