MAP1

AcronymDefinition
MAP1Microtubule-Associated Protein 1 (polypeptide)
MAP1Major Antigenic Protein 1
References in periodicals archive ?
Ehr DSB 330F dsb GATGATGTCTGAAGATATGAAACAAAT Genus Ehr DSB 728R dsb CTGCTCGTCTATTTTACTTCTTAAAGT Genus Ehr maplF map1 ATTTTTACCTGGTGTGTCCTTTTCTGA Genus Ehr mapIR map1 CCTTCCTCCAATTTCTATACC Genus Ehr Pmap2F map1 GACACCAAGGCAGTATACGG Genus Ehr Pmap2R map1 CTAAGTCAGTACCAATACCTGCAC Genus Tick DNA 16S-1 mt16S CCGGTCTGAACTCAGATCAAG Unknown 16S+2 mt16S TTGGGCAAGAAGACCCTATGAA Unknown Amplicon, Primer name bp Reference Borrelia spp.
Sera were tested in duplicate for their reactivity against plate-coated peptides: MAP1,[4[alpha]gbp.sub.157-173] (M1); [PI.sub.64-80] (P1); [MAP2404c.sub.70-85] (M2); [PI.sub.46-61] (P2); [MAP3865c.sub.133-141] (M3); Zn[T8.sub.186-194] (Z3); [MAP3865c.sub.125-133] (M4); Zn[T8.sub.178-186] (Z4).
At 12 d of storage, pH value of MAP2 and MAP3 were higher (p<0.05) than that of MAP1 and pH value of MAP1 was higher (p<0.05) than that of VP.
10, while it was trained using only data from map1. Fig.11 shows that FTBN can guide the robot in unseen environment with an acceptable accuracy.
* Inicialmente el nodo movil esta recibiendo paquetes desde el nodo correspondiente a traves del MAP1 y del AR2.
(MAP1) ASIAN LONGHORNED BEETLE / Massachusetts regualted area (MAP 2) ASIAN LONGHORNED BEETLE / New Jersey (CHART 1) Asian longhorned beetle host tree categories (CHART 2) Jersey's beetle battle (CHART 3) Asian longhorned beetles
"Deteccion de ocratoxina a en higos secos utilizando el anticuerpo MAP1 y una tecnica de ELISA competitivo" Miguel Angel Pavon Moreno, Ruth Blanco Rojo e Isabel Gonzalez Alonso Tutoras: Teresa Garcia Lacarra y Rosario Martin de Santos Dpto.
Standby Database server (map1) UNIX server configured with an Oracle 8.0.5 RDBMS and VISION*/MAP software.
Map1 shows two clusters of contiguous districts in Pakistan whose rural population densities are 400 persons or more per sq.
On the molecular level, plectin binds to a variety of cytoskeletal proteins, including cytoplasmic and nuclear IF subunit proteins (vimentin, GFAP, cytokeratins, neuro-filament proteins, lamin B), subplasma membrane proteins (fodrin and [Alpha]-spectrin), and high molecular weight microtubule-associated proteins MAP1 and MAP2 (Herrmann and Wiche, 1987; Foisner et al., 1988; Wiche et al., 1993).