MCT1

AcronymDefinition
MCT1Mono Carboxylate Transporter 1 (protein expression)
References in periodicals archive ?
List of porcine primers Gene Sequence of nucleotide NCBI/Reference (5' [right arrow] 3') MCT1 F: ATGGGCATCAACTACCGACTTC EU404088.
Halestrap, "Isoform-specific regulation of the lactate transporters MCT1 and MCT4 by contractile activity," American Journal of Physiology--Endocrinology and Metabolism, vol.
Currently, there are 14 known members of this family in which MCT1 and MCT4 isoforms (expressed in striated skeletal muscle) carry important metabolic compounds such as pyruvate, lactate, and ketone bodies in co-electroneutral transport of a proton ([H.
Effects of strength training on muscle lactate release and MCT1 and MCT4 content in healthy and type 2 diabetic humans.
The MCTs within skeletal muscles that assist in this transport of lactate are known to be MCT1 and MCT4.
Because of its higher concentration compared to pyruvate, muscle lactate would be transported across the inner mitochondrial membrane by MCT1 (Gladden 2008).
These mutations lead to increased gene transcription and increased MCT1 expression, selectively in [beta]-cells.
There have been relatively few studies that have investigated changes in monocarboxylate transporters, MCT1 and MCT4, to altitude exposure (Clark et al.
F Short-term training increases human muscle MCT1 and femoral venous lactate in relation to muscle lactate.
The plasma membrane transporter MCT4, but not MCT1, is up-regulated by hypoxia through a HIF-1(alpha)-dependent mechanism.
It was concluded that the enhanced ability to take up lactate by the trained muscles was due to the increase in MCT1 transporters (Bonen, 2000).