MECA


Also found in: Wikipedia.
AcronymDefinition
MECAMaine College of Art
MECAMiddle East Children's Alliance
MECAMaritime Electronic Commerce Association
MECAManufacturers of Emission Controls Association (Washington, DC)
MECAMars Environmental Compatibility Assessment (NASA JPL)
MECAMarriage Equality California
MECAMontana Electric Cooperatives Association
MECAMetropolitan Emergency Communications Agency (Marion County, Indiana)
MECAMiddle East Citizens Assembly
MECAMuslim Educational and Cultural Association
MECAMuseum of Ephemeral Cultural Artifacts
MECAMetal Castings
MECAMalleable Embedded Communications Accelerator
MECAMinority E-Commerce Association
MECAMedical Equipment Compliance Associates, LLC (Oak Creek, WI)
MECAMichigan Exploratory Center on the Demography of Aging
MECAManitou Environmental Citizens Action
MECAMissile Electronics Computer Assembly
MECAMap Exercise Computer Assistance
MECAModification, Extension, and Consolidation Agreement
MECAMichigan Electrical Contractors Association
MECAMicrowave Electronic Components of America (Denville, NJ)
References in periodicals archive ?
Staphylococcal DNA was extracted in guanidine isothiocyanate solution (Invitrogen, Carlsbad, USA) and the mecA gene was detected by PCR with specific primers: mecA (1): 5' TGGCTATCGTGTCACAATCG, mecA (2): 5' CTGGAACTTGTT GAGCAGAG [21].
Partie a la conquete du marche europeen MECA PROVENCE--IDEA INTERNATIONAL, a franchi toutes les frontieres et vous pouvez trouver son savoir-faire en Europe, USA, Amerique du Sud, Afrique du Nord, Afrique du Sud, Golfe Perique, Chine, Indonesie, Australie.
Recently, molecular methods, including PCR, branched DNA, and cycling probe assays, have been described that identify mecA sequences from individual S.
Frenchman Lecat, who finished fourth in Friday's 5km race just behind Meca, beat the Spaniard into second place by just 6.4 seconds after more than five hours of racing in the cool waters of Lake Nuuksio outside the Finnish capital.
EN EL LIBRO DEL ESPANOL Diego Sanchez Meca se estudian algunas de las formulaciones mas influyentes de los proyectos modernos de construccion/disolucion de la individualidad que se producer al margen de un proceso mas general de transformacion del pensamiento, en virtud del cual la insistencia en una fundacion del sujeto de caracter metafisico va dejando paso a un desmembramiento del principio de individuacion.
Camerlengo joined MECA in 1973 and has held management positions in product publicity, consumer affairs, corporate affairs, corporate advertising and corporate public relations.
The protocol was signed by Eng Ahmed bin Zaher al Hinai, director general of Environmental Affairs at MECA, and Dr Abdullah bin Sulaiman al Abri, director of Ejaad.
The teachers' proposed pay increases are comparable to the 2018 NZNO/DHB MECA pay rises.
More tests will be conducted in the coming days, Meca said.
The MECA Foundation's mission aims to provide total wellness for Wisconsin police k-9's offering early veterinary care, raising funds to help purchase and train police K-9's for police departments, providing police K-9's with protective vests, supplying the police K-9 units with various equipment (including, but not limited to police K-9 vehicles) and more.
Muscat: People in Oman can now get free seedlings of wild trees from the Ministry of Environment and Climate Affairs (MECA), as a part of its campaign to promote growing more local trees in the Sultanate.