MLUI

AcronymDefinition
MLUIMichigan Land Use Institute
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
Recombinant plasmids were verified by sequencing, restriction digestion with MluI and NdeI and further verified by PCR amplification of whole gene of jefA from plasmid DNA isolated from E.
1 shows, we designed the amplification linker to ligate to the overhang left by HpyCh4IV digestion and simultaneously to create a site for the relatively rare-cutting enzyme, MluI. When amplification occurs as intended with the linkers ligated to HpyCh4IV sites, subsequent MluI digestion of products cleaves off the linker sequence.
Southern blot analysis performed with ApaI, EcoRI, KpnI, MluI, SmaI, SalI, MspI, and PvuII restriction enzymes indicated that, in this region, large genomic rearrangements or extensive changes in methylation pattern did not occur (data not shown).
The gene-specific forward and reverse primers contained restriction enzyme sites (MluI and BglII, resp.); the PCR product was digested with MluI and BglII, analyzed on a 1.0% agarose gel, and purified using a DNA extraction kit (Qiagen, Valencia, CA, USA) according to the manufacturer's instructions.
The linear DNA fragment of this event, obtained by digestion with the restriction endonuclease MluI, contained two gene expression cassettes consisting of (i) the cry3Bb1 coding region regulated by the root-enhanced 4-AS1 plant promoter, the wheat chlorophyll a/b-binding protein (wtCAB) leader, rice actin intron, and the wheat heat shock protein (tahsp17 3') transcriptional terminator and (ii) the nptII (Beck et al., 1982) coding region regulated by the 35S promoter, and the NOS 3' transcriptional terminator (Table 1).
PV-ZMGT32 was digested with MluI to liberate an approximately 6.7-kb fragment containing both CP4 EPSPS cassettes.
Following digestion, 5 mL of 10 mM ATP, 1 mL of T4 ligase, and 1 [micro]L (1 mg) of an MluI adapter (consisting of a 21 mer: 5'CTCTTGCTTACGCGTGGACTA3' and a 25 mer: 5'TAGTCCACGCGTAAGCAAGAGCACA3') were added.