MSP4Merozoite Surface Protein 4/5
Copyright 1988-2018, All rights reserved.
References in periodicals archive ?
The phylogenetic trees for groEL (Figure, panel A) and msp4 (Figure, panel B) loci have similar topologies with strong support for 2 main clades (Figure, panels A and B), each with different host and vector association.
The msp4 sequence for the same sample (KF031406) belonged to clade 1, and contained sequences of a strain found in 96 infected persons in the United States.
Sequence analysis of the msp4 gene of Anaplasma phagocytophilum strains.
El objetivo de este trabajo fue amplificar las secuencias repetidas del gen que codifica la proteina de mayor de superficie (msp4), optimizando y aplicando la tecnica de Nested-PCR (nPCR), para determinar la presencia de A.
Para la seleccion y diseno de las secuencias nucleotidicas se utilizo la plataforma Blast, Primer3 y el programa Vector NTI Suite v11.5, dos juegos de iniciadores dirigidos a flanquear el segmento de la secuencia del gen que codifica la proteina mayor de superficie, msp4, fueron identificados para la PCR como: Ana.Msp 4-F (5' CACCATGAATTACAGAGAATTG 3') y Ana.Msp 4-R (5' GCTGAACAGGAATCTTGCTCC 3').
Anaplasma marginale: analisis de las secuencias del fragmento variable del gen msp1 a y del gen msp4 de cuatro nuevas cepas mexicanas.
To study the phylogenetic relationships between cognate sequences, we included in our analysis all sequences available in GenBank for genes ankA and msp4. To account for recombination events that affect ankA and msp4 (data not shown) in phylogenetic analyses, we used Neighbor-Net networks (Figure).
groEL and msp4 genes showed a 1,650-bp sequence (FJ477840, corresponding to 748 of 1,650 bp) and an 852-bp sequence (FJ460443) for these genes, respectively.
phagocytophilum, the insensitivity of this locus for intraspecies delineation led us to attempt sequence typing on the basis of a more variable locus, msp4 (6,28).
Seven msp4 sequence types were obtained from infected roe deer.
phagocytophilum msp4 sequence types present in GenBank (as of August 1, 2008), the 6 new alleles reported in this study, and homologous sequences available for the closely related species A.