MSPL


Also found in: Medical.
AcronymDefinition
MSPLMicrosoft Permissive License
MSPLMittal Steel Point Lisas (Trinidad and Tobago)
MSPLMunising School Public Library (Munising, MI)
MSPLMaximum Sound Pressure Level
MSPLModified Set Partitioning Labelling
MSPLManitou Springs Public Library (Manitou Springs, CO)
MSPLMount Sterling Public Library (Ohio)
MSPLMember State Project Leader (EU)
References in periodicals archive ?
Primer sequences and their related PCR product sizes for the WNT3 rs3809857 and rs9890413 polymorphisms Variants Primer sequences (5'[right arrow]3') Size (bp) Restriction enzymes rs3809857 GGTCATCGTCTCTGCATGTG 285 BamHI CTTCCTTCTTGCAGCACTCG3 rs9890413 CTCTCTTCCTGCCCCAGTC 177 Mspl AGGACAGGGCTAGGGAGTG Variants Primer sequences (5'[right arrow]3') RFLP fragments (bp) GG 285 rs3809857 GGTCATCGTCTCTGCATGTG GA: 150+135+285 CTTCCTTCTTGCAGCACTCG3 AA: 150+135 GG:78+99 rs9890413 CTCTCTTCCTGCCCCAGTC GA: 177+78+99 AGGACAGGGCTAGGGAGTG AA: 177 Table 2.
[8.] Barrera, S.M., et al., (Genotypic survey of Plasmodium falciparum based on the mspl, msp2 andglurp genes by multiplex PCR).
Digestion was performed with restriction enzymes Mspl and TaqI.
MSPL also caters to international markets for the exports of a wide range of permanent magnets to clients across the globe, including industry leaders from the food processing industry, pharmaceutical industry, cement manufacturers, chemical industry, plastic moulding, steel and heavy industry.
Furin cleaves only HA with the [R.bar]-X-K/R-R motif in the presence of calcium but not the other motif, whereas type II membrane proteases, mosaic serine protease large form (MSPL) and its splice variant transmembrane protease serine 13 (TMPRSS13) recently found by us, with unique substrate recognition of paired basic residues at the cleavage site, efficiently cleave both type motifs, [K/R.bar]-K/R-K/T-R, even under calcium-free conditions, (30) suggesting that these type II membrane proteases facilitate the replication of a wide range of strains of HPAI virus subtypes.
We collected electrocardiograms from 49 subjects under four conditions: R, PL, MS and MSPL. Then the time domain, the frequency domain and the nonlinear parameters of HRV were calculated.
MSPL = 20 log d + 20 log f + 20 log [4[pi]/c] + N x [L.sub.I].
In areas of intense transmission, mspl, mspl and glurp have proved very polymorphic and highly effective in discriminating recrudescent from re-infecting alleles (4).
The Elute Mammalian Genomic DNA Purification Miniprep Kit (Sigma-Aldrichgen, G1N10) was used to isolate DNA from the tissue, The size of DNA was cut by the restriction enzymes Hpall and Mspl. The products were resolved in 2% agarose gels prepared in TBE buffer (1 x ) and detected by staining with ethidium bromide.
The extensive sequence divergence in variable domains of orthologs mspl has been maintained by balanced selection over five million years, most likely as a result of variant-specific immune pressure [50].
The Ministry of Labour and Employment of the Indian government has recognised MSPL Limited, one of India's largest iron ore mining companies, with the President's National Safety Award.
La tercera hipotesis estriba en el hecho de la desarticulacion y reemplazo de la matriz sociopolitica latinoamericana (MSPL) por una matriz mercado-centrica o neoliberal.