NCOI

AcronymDefinition
NCOINational Committee on Inquiry (National Association of Social Workers)
NCOINational Competition in Organ Improvisation (American Guild of Organists)
NCOINederlands Commercieel Opleidings Instituut (Dutch: Dutch Commercial Training Institute)
NCOINorth County Orthopedics, Inc. (Missouri)
NCOINational Congress on Integrity
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
Jung et al., "Polymorphic structure of the tumor necrosis factor (TNF) locus: an NcoI polymorphism in the first intron of the human TNF-beta gene correlates with a variant amino acid in position 26 and a reduced level of TNF-beta production," Journal of Experimental Medicine, vol.
SNP Primers Amplicon RE (bp) -318C>T F: 5'-AAATGAATTGGACTGGATGGT-3' 247 MseII R: 3'-TTACGAGAAAGGAAGCCGTG-5' +49A>G F: 5'-TTGCTCTACTTCCTGAAGACCTGAA-3' 166 BbvI R: 3'-AAAGTCTCACTCACCTTTGCAGAAG-5' CT60 A>G F: 5'-CAC CACTATTTGGGATATACC-3' 216 NcoI R: 3'-AGGTCTATATTTCAGGAAGGC-5' SNP Temperature and Products of duration of digestion (bp) and digestion genotypes -318C>T 37[degrees]C, CC: 247 CT: 20, 95, overnight 132, 247 TT: 20, 95, 132 +49A>G 37[degrees]C, AA: 166 AG: 76, 90, overnight 166 GG: 76, 90 CT60 A>G 37[degrees]C, AA: 20, 196 AG: 20, overnight 196, 216 GG: 216 Table 3: Genotype and allele frequencies of CTLA-4 gene polymorphisms in Pv patients and control and the association of these polymorphisms with Pv.
The synthesized traceable C426 avimer fragment with ~280 bp-long was excised from plasmid DNA of pGH-C426avimer (~3340 bps) by NcoI and HindIII double digestion (Figure 6B).
The introduction of an unpaired base (C-A) at position 17 of the forward primer, located near the mutation site, allowed for the establishment of an endonuclease NcoI restriction site.
NcoI, HindIII and T4 DNA ligase, were all purchased from New England Biolabs (Ipswich, MA, USA).
The resultant PCR products were digested with NcoI (New England Biolabs, Beverly, Massachusetts, USA).
Ten microlitres of PCR product in a 30l volume for HSPA1B:c.1059Ggreater than A and HSPA1L:c.1478Cgreater than T were separately digested with 1.5 units of PstI and NcoI (Fermentas) at 37C for 2h.
The 5.1 kb 5' arm fragment of porcine [beta]-casein gene was cloned by polymerase chain reaction (PCR) amplification using a forward primer with an additional NotI site (GCGGCCGCGATATCTAGGGTCT CTTCTAGT) and a reverse primer with an additional NcoI site (CCATGGCGATCAAGTCCTGTGAATGGGGAA).
Amplified products were digested: [XRCC.sub.2] (Arg188His) with 3U Haemophilus parahaemolyticus (HphI), and [XRCC.sub.3] ([Thr.sub.241]Met) was digested with 3U Nocardia corallina (NcoI) (New England Biolabs, INC UK) [21].
Single base polymorphism in the human tumour necrosis factor alpha (TNF alpha) gene detectable by NcoI restriction of PCR product.
The primers append 5' and 3' termini of the amplicon with flanks bearing recognition sites for the restriction enzymes NcoI and XhoI, respectively.