NGOM

AcronymDefinition
NGOMNorthern Gulf of Mexico
NGOMNet Generation Output Metering (utilities; California)
References in periodicals archive ?
Ngom explained that for a successful demographic dividend in Nigeria, religious and traditional rulers must lead the change, adding that sustainable change happened at the local level.
Ngom said she thinks she will be more likely to go over and talk to a patient who is alone, after noticing that someone -- an observer from Brightview -- was sitting in the room while she was there.
Caption: Mabingue Ngom (left), UNFPA's Regional Director for West and Central Africa, greets Akinwumi Adesina, president of the African Development Bank
Aunque tambien ellos mismos han titulado el poemario, no se trataria de un titulo arbitrario, al contrario, Raquel Ilombe manifesto su intencion de publicar una segunda edicion de Ceiba durante una entrevista concedida a Mbare Ngom. El libro en si se convierte en manos del lector/a en una especie de arbol de la ceiba, con sus raices, con sus hojas, con sus flores y, sobre todo, con su tronco.
Ngom, "The max-min high-order dynamic Bayesian network learning for identifying gene regulatory networks from time-series microarray data," in Proceedings of the 10th Annual IEEE Symposium on Computational Intelligence in Bioinformatics and Computational Biology, CIBCB 2013-2013 IEEE Symposium Series on Computational Intelligence, SSCI 2013, pp.
(10.) Ngom P et al., Gate-keeping and women's health seeking behavior in Navrongo, northern Ghana, African Journal of Reproductive Health, 2003, 7(1): 17-26.
Finally, in his afterword, Ngom addresses the problematic involvement of private actors providing linguistic services to determine the country or region of origin of asylum seekers.
He was ably supported by Vernon Leon Macklin, Babcar Marone Ngom and Fadi Hani Abilmona, who scored 19, 14 and 10 points respectively.
"All trading activities at the Gamboru cattle market, Dusuman, Shuwari and Ngom are suspended until further notice," Gov.
An Ala/Val polymorphism in the signal peptide of Mn-SOD gene was evaluated using a primer pair (forward 5' ACCAGCAGGCAGCTGGCGCCGG 3' and reverse 5' GCGTTGATGTGAGGT TCCAG 3') to amplify a 107 bp fragment followed by digestion with the NgoM IV gene from Neisseria gonorrhoeae MS11 (NgoM IV) recognizes the nucleotide sequence as a restriction site GCCGGC (Figure 1).
Esta obra podria representar una continuacion de dos excelentes obras sobre literatura hispanoafricana: De Guinea Ecuatorial a las literaturas hispanoafricanas coordinado por Landry-Wilfrid Miampika y Patricia Arroyo en 2010 y Palabra abierta Conversaciones con escritores africanos de expresion en espanol (2013) de Mbare Ngom.
UPDF, he said, had deployed at Ngom Oromo border point and Pogee village as they were claiming in Lokung sub-county in Lamwo district to repulse an invasion by South Sudanese nationals.