NIAW

AcronymDefinition
NIAWNational Infertility Awareness Week
References in periodicals archive ?
Both located in South Wales, NIAW and Intelligent Ultrasound share a common desire to improve ultrasound practice through education, innovation and research that will lead to improved clinical technique and as a result, improved patient care and outcomes.
Breakfast News - Voyager AIR, Thalassa Holdings, Strategic Minerals and more.
"National Infertility Awareness Week is a movement to raise awareness about the disease of infertility and our support of NIAW helps to break down barriers of isolation and loneliness.
Free IVF cycle for a couple each year
Nineteen wheat genotypes (Sonara 64, K 9351, HP 1633, Raj 4037, Sharbati Sonara, K 9533, K 8434, NP 823, Ajanta, PBW 12, KRL, RW 346, HD 2643, HS 1097, NP 825, PBW 226, NIAW 301, PBW 343, and NI 179) were selected on the basis of low disease severity under field conditions for molecular validation of stripe rust resistance gene Yr18 by using allele-specific markers Cssfr2 (F=TTGATGAAACCAGTTTTTTTTCTA R=TATGCCATTTAACATAATCATGAA).
Germplasm Evaluation and Characterization of Slow Rusting Resistant Gene against Stripe Rust of Wheat
v3###Purple###Khao gam (niaw)###15005###Thailand###Landrace/Traditional cultivar
Micronutrients, Antioxidant Activity, and Tocochromanol Contents of Selected Pigmented Upland Rice Genotypes
Menu includes Pad Thai (stir-fried noodles with shrimp); Khao Mok Gai (chicken biriyani with yellow rice); Yum Tuna Fu (crispy tuna with shredded green mango salad); and Khao Niaw Sangkhaya (sticky rice with coconut custard).
ENTREE NOTES
Tenders are invited for Maintenance Operation electrical installation and fans sstn cl pset dg set at niaw sikri ballabgarh faridabad dg 2018 19
Maintenance Operation Electrical Installation And Fans Sstn Cl Pset Dg Set At Niaw Sikri Ballabgarh Faridabad Dg 2018 19
Tenders are invited for misc electrical works in connection with Moei and fans cl pset substation d.g set at niaw sikri
Misc Electrical Works In Connection With Moei And Fans Cl Pset Substation D.g Set At Niaw Sikri
Tenders are invited for Internal finishing of girls hostel renovation of toilets in boys hostel changing of fittings in toilet of guest house at niaw sikri during 2018 19
Internal Finishing Of Girls Hostel Renovation Of Toilets In Boys Hostel Changing Of Fittings In Toilet Of Guest House At Niaw Sikri During 2018 19
Tenders are invited for Moei and fans compound light pump set sub station dg set at niaw sikri sh repairing of feeder pillar and street light
Moei And Fans Compound Light Pump Set Sub Station Dg Set At Niaw Sikri Sh Repairing Of Feeder Pillar And Street Light
Tenders are invited for External Finishing And Repair Works in connection with Annual repair & Maintenance Operation To Niaw Sikri Dg 2017-18
External Finishing And Repair Works
Tenders are invited for Repairing Of Submersible Pump Sets in connection with Providing Electrical And Mechanical Work Services For Rli Building At Sector 47 Faridabad Moei And Fans C Light P/Set Sub/Stn Dg Set At Niaw Sikri
Repairing Of Submersible Pump Sets In Connection With Providing Electrical And Mechanical Work Services For Rli Building At Sector 47 Faridabad Moei And Fans C Light P/set Sub/stn Dg Set At Niaw Sikri
Tenders are invited for Moei And Fans S/Stn C/L P/Set Dg Set At Niaw Sikri Ballabgarh Faridabad Dg 2017 18
Moei And Fans S/stn C/l P/set Dg Set At Niaw Sikri Ballabgarh Faridabad Dg 2017 18
Acronyms browser ?
Full browser ?