Both located in South Wales,
NIAW and Intelligent Ultrasound share a common desire to improve ultrasound practice through education, innovation and research that will lead to improved clinical technique and as a result, improved patient care and outcomes.
Nineteen wheat genotypes (Sonara 64, K 9351, HP 1633, Raj 4037, Sharbati Sonara, K 9533, K 8434, NP 823, Ajanta, PBW 12, KRL, RW 346, HD 2643, HS 1097, NP 825, PBW 226,
NIAW 301, PBW 343, and NI 179) were selected on the basis of low disease severity under field conditions for molecular validation of stripe rust resistance gene Yr18 by using allele-specific markers Cssfr2 (F=TTGATGAAACCAGTTTTTTTTCTA R=TATGCCATTTAACATAATCATGAA).
Menu includes Pad Thai (stir-fried noodles with shrimp); Khao Mok Gai (chicken biriyani with yellow rice); Yum Tuna Fu (crispy tuna with shredded green mango salad); and Khao
Niaw Sangkhaya (sticky rice with coconut custard).