NK3

AcronymDefinition
NK3Neurokinin Receptor 3
References in periodicals archive ?
Se utilizo un diseno factorial completamente al azar de 4 cultivares (cvs) (Terragina, Gucci, Pacific y Codigo Rojo) X 4 relaciones N/K (NK1: 1,16; NK2: 0,75; NK3: 0,55; y NK4: 0,45) con tres repeticiones de ocho plantas cada una.
Effect of the N/K ratio on yield and quality of gerbera for flower cutting/Efecto de la relacion N/K en el rendimiento y calidad de gerbera para flor de corte/Efeito da relacao N/K na produtividade e qualidade do gerbera para o corte de flor
Table 1: Primer details Gene Primer Sequence (5' [right arrow] 3') tcdA * NK11 F (5'TGATGCTAATAATGAATCTAAAATGGTAAC -3') NK9 R (5'CCACCAGCTGCAGCCATA -3') tcdA ([dagger]) NK3 F (5'GGAAGAAAAGAACTTCTGGCTCACTCAGGT-3') NK2 R (5'CCCAATAGAAGATTCAATATTAAGCTT-3') tcdB ([dagger]) NK104 F (5'GTGTAGCAATGAAAGTCCAAGTTTACGC -3') NK105 R (5'CACTTAGCTCTTTGATTGCTGCACCT -3') Annealing Gene Primer Length temp ([degrees]C) tcdA * NK11 30 55[degrees]C NK9 18 tcdA ([dagger]) NK3 30 55[degrees]C NK2 27 tcdB ([dagger]) NK104 28 55[degrees]C NK105 26 Product size Gene Primer (bp ([double dagger])) tcdA * NK11 1200bp NK9 tcdA ([dagger]) NK3 250bp NK2 tcdB ([dagger]) NK104 200bp NK105 * Repeating region, ([dagger]) Nonrepeating region, ([double dagger]) base pair.
Polymerase chain reaction for the detection of toxin a (TCD A) and toxin B (TCD B) genes of Clostridium difficile isolated from diarrhoeal cases and analysis of the clinical spectrum
Morrish, "Gene regulation of neurokinin B and its receptor NK3 in late pregnancy and preeclampsia," Molecular Human Reproduction, vol.
Assessment of tachykinin receptor 3' gene polymorphism rs3733631 in rosacea
Miroinjection of tachykinin receptor agonists of NK1, NK2 and NK3 into the VTA are shown to increase BP and HR.
Evaluation of GABA receptors of ventral tegmental area in cardiovascular responses in rat
Three tachykinin receptors are known: NK1, NK2, and NK3. NK3 receptor (NK3R) predominantly mediated the effects of NKB [2].
Effect of nourishing "Yin"-removing "Fire" Chinese herbal mixture on hypothalamic NKB/NK3R expression in female precocious rats
Asimismo, se han descrito NK3 que producen TGF[beta] y mas recientemente NKr1 que producen IL-10 (71).
Inmunologia del embarazo
Sequence alignments (tBlastn) using homeodomains of proteins belonging to NK2, NK3, NK4, NK5, NK6, NK7, Msx, Hex, and Tlx families were derived from Lottia gigantea, Branchiostoma floridae, and Ciona intestinalis genome contigs available at http://genome.jgi-psf.org/ and from Caenorhabditis elegans and Drosophila melanogaster genomes at WormBase (http://www.wormbase.org/) and FlyBase (http://www.flybase.org/), respectively.
Does the high gene density in the sponge NK homeobox gene cluster reflect limited regulatory capacity?
The resulting ASMPA programme was announced in 2000, and deliveries of the new weapon for the Mirage 2000 NK3 and Rafale are due to begin in 2007.
Air-to-ground weapons
Kazuki Saito (Chiba University, Chiba, Japan) for providing us with the NK3 E.
Sulfur assimilation in soybean: molecular cloning and characterization of O-acetylserine (thiol) lyase (cysteine synthase)
The planned expenditure for the year is 4,793,863,326,283,000 new kwanzas (NK), with revenue put at NK3,880,103,863,202,000.
The deadly menace of the mines
In addition, immunostains for organ-specific immunomarkers revealed tumor cells that were positive for paired box gene 8 (PAX-8) and negative for thyroid transcription factor-1 (TTF-1) and NK3 homeobox 1 (NKX3.1).
Application of Immunohistochemistry in Undifferentiated Neoplasms: A Practical Approach
Acronyms browser ?
Full browser ?