NK3

AcronymDefinition
NK3Neurokinin Receptor 3
References in periodicals archive ?
Se utilizo un diseno factorial completamente al azar de 4 cultivares (cvs) (Terragina, Gucci, Pacific y Codigo Rojo) X 4 relaciones N/K (NK1: 1,16; NK2: 0,75; NK3: 0,55; y NK4: 0,45) con tres repeticiones de ocho plantas cada una.
Table 1: Primer details Gene Primer Sequence (5' [right arrow] 3') tcdA * NK11 F (5'TGATGCTAATAATGAATCTAAAATGGTAAC -3') NK9 R (5'CCACCAGCTGCAGCCATA -3') tcdA ([dagger]) NK3 F (5'GGAAGAAAAGAACTTCTGGCTCACTCAGGT-3') NK2 R (5'CCCAATAGAAGATTCAATATTAAGCTT-3') tcdB ([dagger]) NK104 F (5'GTGTAGCAATGAAAGTCCAAGTTTACGC -3') NK105 R (5'CACTTAGCTCTTTGATTGCTGCACCT -3') Annealing Gene Primer Length temp ([degrees]C) tcdA * NK11 30 55[degrees]C NK9 18 tcdA ([dagger]) NK3 30 55[degrees]C NK2 27 tcdB ([dagger]) NK104 28 55[degrees]C NK105 26 Product size Gene Primer (bp ([double dagger])) tcdA * NK11 1200bp NK9 tcdA ([dagger]) NK3 250bp NK2 tcdB ([dagger]) NK104 200bp NK105 * Repeating region, ([dagger]) Nonrepeating region, ([double dagger]) base pair.
Morrish, "Gene regulation of neurokinin B and its receptor NK3 in late pregnancy and preeclampsia," Molecular Human Reproduction, vol.
Miroinjection of tachykinin receptor agonists of NK1, NK2 and NK3 into the VTA are shown to increase BP and HR.
Three tachykinin receptors are known: NK1, NK2, and NK3. NK3 receptor (NK3R) predominantly mediated the effects of NKB [2].
Asimismo, se han descrito NK3 que producen TGF[beta] y mas recientemente NKr1 que producen IL-10 (71).
Sequence alignments (tBlastn) using homeodomains of proteins belonging to NK2, NK3, NK4, NK5, NK6, NK7, Msx, Hex, and Tlx families were derived from Lottia gigantea, Branchiostoma floridae, and Ciona intestinalis genome contigs available at http://genome.jgi-psf.org/ and from Caenorhabditis elegans and Drosophila melanogaster genomes at WormBase (http://www.wormbase.org/) and FlyBase (http://www.flybase.org/), respectively.
The resulting ASMPA programme was announced in 2000, and deliveries of the new weapon for the Mirage 2000 NK3 and Rafale are due to begin in 2007.
The planned expenditure for the year is 4,793,863,326,283,000 new kwanzas (NK), with revenue put at NK3,880,103,863,202,000.
In addition, immunostains for organ-specific immunomarkers revealed tumor cells that were positive for paired box gene 8 (PAX-8) and negative for thyroid transcription factor-1 (TTF-1) and NK3 homeobox 1 (NKX3.1).